We narrowed to 13,535 results for: Mpl
-
Plasmid#127353Purposegateway entry vector for making C-terminal TurboID-mVenus fusion with non-nuclear proteinsDepositorInsertTurboID (BirA mutant)
UseGateway entry vectorTagsGS linker, NES, V5, and mVenusMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…Promoterno promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1 p37deltaSEP
Plasmid#113501PurposeBacterial expression of GST-tagged p37 lacking the SEP domainDepositorInsertp37 (Ubxn2b Mouse)
TagsGST-PreScission protease siteExpressionBacterialMutationdelta 140-206Available SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-UL29-egfp-U3-UL8
Plasmid#166694PurposeTo express gRNA expression cassette simultaneously targeting two genes: UL8 and UL29 (EGFP version).DepositorAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag-betaPIXa
Plasmid#15234DepositorAvailable SinceSept. 13, 2007AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-PXN
Plasmid#227317PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the PXN locus. For focal adhesion visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PXN (Addgene #227315)DepositorInsertPXN Homology Arms flanking a mStayGold-2A-Puro Cassette (PXN Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-mCherry-CLCN3
Plasmid#225514PurposeLentiviral mCherry-CLCN3 expression vectorDepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBac_His-ZZ-TEV-Lis1-SNAPf
Plasmid#133073PurposePlasmid for insect cell expression of human full-length LIS1 with an N terminal His-ZZ-LTLT tag and C terminal SNAPf tagDepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
OPEN-HLA-B*07:02-BirA
Plasmid#239752PurposeE. coli expression of BirA tagged HLA-B*07:02 containing a cysteine mutation for disulfide linkage to mutant beta-2 microglobulinDepositorInsertOPEN-HLA-B*07:02 (HLA-B Human)
TagsBirA substrate peptideExpressionBacterialMutationG120CPromoterT7Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
OPEN-HLA-A*11:01-BirA
Plasmid#235135PurposeE. coli expression of BirA tagged HLA-A*11:01 containing a cysteine mutation for disulfide linkage to mutant beta-2 microglobulin.DepositorAvailable SinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only