We narrowed to 8,896 results for: sgRNA
-
Plasmid#208392PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ATM gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only
-
Lenti-sgRNA-Cre-GpNLuc-sgmMRE11
Plasmid#208384PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MRE11 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#3
Plasmid#208389PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#3 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMLKL
Plasmid#208391PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MLKL gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 hU6 ACTB sgRNA
Plasmid#206270PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes hU6 hACTB sgRNADepositorInsertACTB sgRNA
UseCRISPR; Multimate/gateway entr 2ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRExpressionMammalianPromotercmb and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-tdTomato-sgRNA
Plasmid#194724Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA that target tdTomatoDepositorInsertAsCpf1
UseCRISPRExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-3 lentiCRISPR v2-Blast plasmid
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-5 lentiCRISPR v2-Blast plasmid
Plasmid#192230Purposelentiviral vector expressing sgRNA-5 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-5 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192234Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192229Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Flag-Mcm2 targeting sgRNA
Plasmid#186937PurposeGenomic targeting of Flag tag at Mcm2 N-terminalDepositorAvailable SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
330-BFP-hCYP3A4-enhancer-R-sgRNA
Plasmid#176841PurposeTargeting human CYP3A4 proximal enhancer right boundary. sgRNA expressing cells could be FACS sorted by BFP expression.DepositorInsertHuman CYP3A4 proximal enhancer right boundary
ExpressionMammalianPromoterU6Available SinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
330-cherry-hCYP3A4-enhancer-L-sgRNA
Plasmid#176840PurposeTargeting human CYP3A4 proximal enhancer left boundary. sgRNA expressing cells could be FACS sorted by cherry expression.DepositorInsertHuman CYP3A4 proximal enhancer left boundary
ExpressionMammalianPromoterU6Available SinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330.puro sgRNA KGA Stop1
Plasmid#110405PurposeCRISPR/Cas9 vector with sgRNA for glutaminase KGA isoform C-Terminal Knock-in and puromycin resistanceDepositorAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNTI733 pRPR1(TetO)-RPC31-sgRNA
Plasmid#164913PurposeFor yeast genomic integration of sgRNA against RPC31DepositorInsertpRPR1(TetO)-RPC31-sgRNA
UseCRISPRExpressionYeastPromoterRPR1Available SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNTI732 pRPR1(TetO)-HTS1-sgRNA
Plasmid#164912PurposeFor yeast genomic integration of sgRNA against HTS1DepositorInsertpRPR1(TetO)-HTS1-sgRNA
UseCRISPRExpressionYeastPromoterRPR1Available SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA sCRNA 2.0 (GB2461)
Plasmid#160593PurposeVersion of the native Cas9-sgRNA with one native WT aptamer sequence and F6 aptamer sequence recognized for Ms2 coat protein, in 3'.DepositorInsertsgRNA sCRNA 2.0
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only