We narrowed to 5,610 results for: crispr cas9 grna plasmid
-
Plasmid#159536PurposeDelivery of Nme2Cas9 and its sgRNA in a single AAV vector with overall packaging size of 4.4 KbDepositorInsertNme2Cas9 with single guide RNA cassette
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianMutationPromoterU1aAvailable sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA TdR
Plasmid#80940PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdR for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA TdL
Plasmid#80938PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdL for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)sgRNA_CAG-Cas9-bpA_EF1-TagRFP
Plasmid#86987PurposeFor cloning and expression of sgRNA together with expression of Cas9 and TagRFPDepositorInsertCas9
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2
Plasmid#214814PurposeA single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATMDepositorInsertSt1Cas9 CNRZ1066 v2 targeting ATM (ATM Human)
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
1518_pAAV-U6-SA-eGFP-gRNA-HLP-SACas9-HA-OLLAS-spA
Plasmid#109316PurposePlasmid for liver-specific expression of AAV SaCas9 with a gRNA against eGFPDepositorInserteGFP gRNA
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
1476_pAAV-U6-SA-mMttp-gRNA-N21-HLP-SACas9-spA
Plasmid#109315PurposePlasmid for liver-specific expression of AAV SaCas9 with a gRNA against MttpDepositorInsertMttp gRNA
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-ABE-3'UTR-sgRNA-2xMS2
Plasmid#132554PurposeVector plasmid expressing ABEmax and sgRNA scaffold with MS2 replacing the Tetraloop and loop 2DepositorInsertsABEmax
sgRNA, with Tetraloop and loop 2 replaced by MS2 aptamer
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)sgRNA_CAG-Cas9-venus-bpA
Plasmid#86986PurposeFor cloning and expression of sgRNA together with expression of a Cas9-Venus fusion proteinDepositorInsertCas9-venus
UseTagsCas9-Venus fusion proteinExpressionMammalianMutationPromoterCAGAvailable sinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMD9_2xUGI_3xHA
Plasmid#136652PurposeExpresses St1BE4max-LMD9 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianMutationPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_TH1477_2xUGI_3xHA
Plasmid#136659PurposeExpresses St1BE4max-TH1477 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianMutationPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMG18311_2xUGI_3xHA
Plasmid#136657PurposeExpresses St1BE4max-LMG18311 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianMutationPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_CNRZ1066_2xUGI_3xHA
Plasmid#136654PurposeExpresses St1BE4max-CNRZ1066 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianMutationPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-T2A-EGFP-U6-gRNA-no ITR and f1 ori
Plasmid#234724PurposeAll-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in neurons. The plasmid lacks AAV2 ITR and f1 ori elements, enabling more efficient transfection and expression.DepositorTypeEmpty backboneUseCRISPRTagsT2A-GFPExpressionMammalianMutationPromoterCAG promoterAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dCas9-KRAB-gRNA-TRE-blast
Plasmid#201152PurposeLentiviral expression of S. pyogenes dead Cas9 (dCas9/dSpCas9/SpdCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsdCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: TACGTTCTCTATCACTGATPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-NLS-SaCas9-NLS-3xHA-bGHpA-U6-BsaI-sgRNA
Plasmid#218710PurposeAAV vector plasmid expressing Cas9 from Staphylococcus aureus (SaCas9) under the human synapsin (SYN) promoter and its sgRNA under the U6 promoterDepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianMutationPromoterAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Adrb1
Plasmid#184294PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Adrb1DepositorInsertsgRNA-Adrb1
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Grp
Plasmid#184292PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting GrpDepositorInsertsgRNA-Grp
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Oprl1
Plasmid#184291PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Oprl1DepositorInsertsgRNA-Oprl1
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only