We narrowed to 14,484 results for: SHR;
-
Plasmid#170128PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(3'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTX208
Plasmid#89268PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA01 and OsYSA-gRNA02DepositorInsertOsYSA-gRNA01 and OsYSA-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3043(gRNA XI-1)
Plasmid#73285PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-1DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO-neo CXCR4-sh3
Plasmid#163743PurposeLentivirus for inducible knockdown of CXCR4 (human)DepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO-neo CXCR4-sh1
Plasmid#163741PurposeLentivirus for inducible knockdown of CXCR4 (human)DepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO-neo CXCR4-sh2
Plasmid#163742PurposeLentivirus for inducible knockdown of CXCR4 (human)DepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB3049(gRNA XII-4)
Plasmid#73291PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-4DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gLacZ.hSyn.H2B.RFP
Plasmid#170369PurposeNegative control plasmid used for Crispr/cas9 based disruption. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFlag-CMV2-Brd4 S1351R
Plasmid#21941DepositorAvailable SinceSept. 14, 2009AvailabilityAcademic Institutions and Nonprofits only