We narrowed to 8,993 results for: set
-
Plasmid#160871PurposeMarmoset TargetingDepositorInsertmCerulean3
UseMarmoset targetingAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPL5618_pUG_MtxR
Plasmid#60929PurposePCR template vector for generating methotrexate resistance cassette.DepositorInsertDihydrofolate reductase (DHFR Human)
UseLoxp flanked deletion cassette templateMutationL22F F31SPromoterTEF1Available SinceFeb. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEW107
Plasmid#232796PurposeCOMPASS Fragment 2 (His-FLAG-ySet1, Cps30, Twinstrep-Cps40) in pBIG2abDepositorTagsHis6-3xFLAG, TwinstrepExpressionInsectMutationySet1(762-1080)Promoterpolyhedrin promoterAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-8
Plasmid#227670PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. AmR, easily curable via sucrose counterselection.DepositorInsertAmR
ExpressionBacterialAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e2-A39T
Plasmid#129752PurposeGene targeting in marmoset cellsDepositorAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e2-P15L
Plasmid#129753PurposeGene targeting in marmoset cellsDepositorAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
BLADE
Plasmid#134912PurposeEmpty backbone for cloning sgRNA sequence to be used in nanoblades systemDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyPromoterU6Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 N. meningitidis sgRNA BfuAI large stuffer
Plasmid#86195PurposeU6 based expression of N meningitidis sgRNADepositorInsertnmCas9 sgRNA cloning cassete
UseLentiviralPromoterU6Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-2
Plasmid#227667PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. KmR, easily curable via sucrose counterselection.DepositorInsertKmR
ExpressionBacterialAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-4
Plasmid#227668PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. SmR, easily curable via sucrose counterselection.DepositorInsertSmR
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC2-gephyrin C3
Plasmid#199610PurposeEncodes N-terminal eGFP-tagged gephyrin including the C3 splice cassette for expression in mammalian cells.DepositorInsertGephyrin (Gphn Rat)
TagsEGFPExpressionMammalianMutationC3 cassette insertionPromoterCMVAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC2-gephyrin C4a
Plasmid#199611PurposeEncodes N-terminal eGFP-tagged gephyrin including the C4a splice cassette for expression in mammalian cells.DepositorInsertGephyrin (Gphn Rat)
TagsEGFPExpressionMammalianMutationC4a casette insertionPromoterCMVAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTW045
Plasmid#185690PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNAs
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW037
Plasmid#185688PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only