We narrowed to 3,402 results for: aaas
-
Plasmid#78089Purpose3rd generation lentiviral gRNA plasmid targeting human SH3BP4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pLentiCRISPR V2 sgYME1L1 sg1
Plasmid#244867PurposeKnockout of human YME1L1DepositorAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgNANOG
Plasmid#242176PurposeA piggybac-based vector containing mouse U6 promoter-driven NANOG sgRNA and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
XLone-UCE mutant
Plasmid#242185PurposeExpress doxycycline inducible UCE 32S binding mutation of CRNDE in mammalian cellsDepositorInsertCRNDE UCE mutant (CRNDE Human)
ExpressionMammalianMutationATTTTCATGGGC to TAAAAGTACCCGPromoterTRE3GSAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-NPM1-gRNA for HCT116
Plasmid#238249PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to NPM1 locusDepositorInsertNPM1
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-30kb-DSF
Plasmid#227485Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-35kb-DSF-1-6
Plasmid#227487Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-35kb-DSF-6-11
Plasmid#227488Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-35kb-DSF
Plasmid#227490Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-35kb-DSF
Plasmid#227491Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-29kb-USF
Plasmid#227466Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 29kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-25kb-USF
Plasmid#227468Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 25kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-11kb-USF
Plasmid#227473Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 11kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-7.1kb-USF
Plasmid#227474Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 7.1kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-1.9kb-USF
Plasmid#227476Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 1.9kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-2.4kb-USF
Plasmid#227477Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 2.4kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-3.3kb-USP
Plasmid#227450Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 3.3kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-40kb-USF
Plasmid#227460Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 40kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA052H_sgCh2
Plasmid#229023PurposeExpression of a EnAsCas12a control guide that cuts an intergenic region on chromosome 2DepositorInsertsgChr2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only