We narrowed to 45,966 results for: cha
-
Plasmid#183179Purposemyc tagged hsTRPA1 used for cell transfectionDepositorInsertsExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-hSyn1-eYFP
Plasmid#117382PurposeAn AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEYFP
UseAAVExpressionMammalianPromoterhSyn1Available SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pECNUS4
Plasmid#184887PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_OHu19986C_myc tag
Plasmid#183174Purposeused to make AAV vectors for hsTRPA1 tagged with mycDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Lats1 (Nigg HS189)
Plasmid#41156DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1 TIM8,13
Plasmid#170282PurposeExpresses both yeast Tim8 and yeast Tim13 (the latter with cleavable N-ter His-tag), codon-optimized for E. coli productionDepositorInsertyeast Tim8 and Tim13 (TIM8 Budding Yeast)
TagsTEV-cleavable N-terminal His tag on Tim13 (on bac…ExpressionBacterialAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pECNUS4_MP
Plasmid#228358PurposeABE8e-SpCas9-NG Multiplex Acceptor clone for insertion of up to six gRNA cassettes via Golden Gate with BpiI and T4 ligase, blue-white screeningDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS2
Plasmid#184885PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS3
Plasmid#184886PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS1
Plasmid#184884PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSP64-mHCN2
Plasmid#53060PurposeExpresses alpha subunit of mouse HCN2 channel in Xenopus oocytesDepositorInsertPotassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2 (Hcn2 Mouse)
UseXenopus oocyte expressionMutationE55G, R237H, and K283R polymorphisms compared to …PromoterSP6Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
Syn-ATP
Plasmid#51819PurposeOptical reporter of presynaptic ATPDepositorInsertChimeric Synaptophysin-mCherry-Luciferase
ExpressionMammalianMutationWithin WT luciferase gene, changed Threonine 214 …PromoterCMVAvailable SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CPH3486 (YCp LEU2 Rpb1 F1492A)
Plasmid#91808PurposeYeast expression of S. cerevisiae Rpb1 with a F1492A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged phenylalanine 1492 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3487 (YCp LEU2 Rpb1 S1493A)
Plasmid#91809PurposeYeast expression of S. cerevisiae Rpb1 with a S1493A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged serine 1493 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3488 (YCp LEU2 Rpb1 P1494A)
Plasmid#91810PurposeYeast expression of S. cerevisiae Rpb1 with a P1494A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged proline 1494 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3508 (YCp LEU2 Rpb1 Y1473A)
Plasmid#91811PurposeYeast expression of S. cerevisiae Rpb1 with a Y1473A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged tyrosine 1473 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3509 (YCp LEU2 Rpb1 T1471A)
Plasmid#91812PurposeYeast expression of S. cerevisiae Rpb1 with a T1471A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged threonine 1471 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only