We narrowed to 13,571 results for: gan
-
Plasmid#62872PurposeBacterial expression of MBP-MBK-2 K196RDepositorInsertMBP-MBK-2 K196R
TagsMBPExpressionBacterialMutationK196RAvailable SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNH002
Plasmid#42145DepositorInsertN-TAP TAG::[(G4S)3]::mTFP1
TagsTAP TAGExpressionWormAvailable SinceFeb. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pNH026
Plasmid#42148DepositorInsertmTFP1::linker::TAP TAG
TagsTAP-TagAvailable SinceFeb. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pNH001
Plasmid#42144DepositorInsertTAP-tag
TagsTAP-tagExpressionWormAvailable SinceFeb. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1000
Plasmid#44475DepositorInsertMinimal Mos1, PuroR, peel-1, [4-3] Gateway
UseGateway destination vectorAvailable SinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHW621
Plasmid#229867PurposeEntry vector with cGAL[cGAL(DBD)-linker-QFAD]-tbb-3'UTR in slot 5 (for SapTrap assembly)DepositorInsertcGAL[cGAL(DBD)-linker-QFAD]-tbb-3'UTR
ExpressionWormAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac-APEX-V5-NES
Plasmid#229082PurposeDoxycycline-inducible expression of nuclear export signal (NES) fused to V5-tag and APEX for proximity labeling, containing BFP in the backboneDepositorInsertNES (TARDBP Human)
TagsAPEX (D11G mutation), BFP, and V5ExpressionMammalianPromoterTRE3GAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::lite-1G::SL2::his-24::tagBFP
Plasmid#232610PurposePan-neuronal expression of 'LITE-1' using a genomic fragment and fluorophore 'tagBFP', regulated by rab-3 promoter and unc-54 3' UTRDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::gur-3G::SL2::his-24::tagBFP
Plasmid#232608PurposePan-neuronal expression of 'GUR-3' using a genomic fragment and fluorophore 'tagBFP', regulated by rab-3 promoter and unc-54 3' UTRDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::prdx-2G::SL2::his-24::tagRFP
Plasmid#232609PurposePan-neuronal expression of 'PRDX-2' using a genomic fragment and fluorophore 'tagRFP', regulated by rab-3 promoter and unc-54 3' UTRDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1221
Plasmid#229873Purposegene trap RMCE plasmid with QF-act-4 3' UTR::SEC for RMCE cloned in the destination vector pHW1133 to swap driver via RMCEDepositorInsertQF-act-4 3' UTR::SEC
ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1143
Plasmid#229866PurposeEntry vector with FRT-SA-ArtificialExon-3xStopCodons-SL2-AAAA in slot 4 (for SapTrap assembly)DepositorInsertFRT-SA-ArtificialExon-3xStopCodons-SL2-AAAA
ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT318
Plasmid#204508Purposerpl-21 promoter-driven C04F12.1 construct tagged with 2xHA for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsertrpl-21p::2xHA::C04F12.1 (C. elegans)
Tags2xHAExpressionWormPromoterrpl-21 (C. elegans)Available SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT246
Plasmid#204507Purposecsr-1 construct tagged with 2xFLAG for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsert2xFLAG::csr-1 (C. elegans) (csr-1 Nematode)
Tags2xFLAGExpressionWormPromotercsr-1 (C. elegans)Available SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-CeAIN2-W390A_P
Plasmid#147236PurposeInsect Expression of CeAIN2-W390ADepositorInsertCeAIN2-W390A
ExpressionInsectMutationDeletion of two AA SD 378-379 compared to the seq…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-CeAIN1_1-504_P
Plasmid#147238PurposeInsect Expression of CeAIN1_1-504DepositorInsertCeAIN1_1-504 (ain-1 Nematode)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-CeNot1_P
Plasmid#147239PurposeInsect Expression of CeNot1DepositorInsertCeNot1
ExpressionInsectMutationone non silent mutation A610T compared to the seq…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only