We narrowed to 2,726 results for: gem
-
Plasmid#210639PurposeOverexpression of TAL1-longDepositorInsertTAL1-long (TAL1 Human)
UseRetroviralAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 hU6 ACTB sgRNA
Plasmid#206270PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes hU6 hACTB sgRNADepositorInsertACTB sgRNA
UseCRISPR; Multimate/gateway entr 2ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 hU6 HEK3 PegRNA
Plasmid#206277PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes HEK3 PegRNADepositorInsertHEK3 PegRNA
UseCRISPR; Multimate/gateway entr 2ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 3 polH aeBlue polH VSV-G
Plasmid#206278PurposeENTR Vector 3 for MultiSite Gateway assembly. Encodes aeBlue chromoprotein and VSV-G glycoprotein under the control of viral polH promoters.DepositorInsertaeBlue, VSV-G
UseMultimate/gateway entr 3ExpressionBacterial and InsectAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsSmg7-G100E-siRNAres-shRNAres_S
Plasmid#147461PurposeMammalian Expression of HsSmg7-G100E-siRNAres-shRNAresDepositorInsertHsSmg7-G100E-siRNAres-shRNAres (SMG7 Human)
ExpressionMammalianMutationthree silent mutation G216A, T1185C and A1521G an…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsSmg7-K66ER163E-siRNAres-shRNAres_S
Plasmid#147462PurposeMammalian Expression of HsSmg7-K66ER163E-siRNAres-shRNAresDepositorInsertHsSmg7-K66ER163E-siRNAres-shRNAres (SMG7 Human)
ExpressionMammalianMutationthree silent mutation G216A, T1185C and A1521G an…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsSmg7-T103E-siRNAres_S
Plasmid#147464PurposeMammalian Expression of HsSmg7-T103E-siRNAres-shRNAresDepositorInsertHsSmg7-T103E-siRNAres-shRNAres (SMG7 Human)
ExpressionMammalianMutationthree silent mutation G216A, T1185C and A1521G an…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pN1-HsSmg5-Q123E-siRNAres-V5-SBP-MBP_S
Plasmid#147471PurposeMammalian Expression of HsSmg5-Q123E-siRNAresDepositorInsertHsSmg5-Q123E-siRNAres (SMG5 Human)
ExpressionMammalianMutationthree non silent mutation A254G (K85R), T980C (L3…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGW02 AAV-TBG-Cre-sgP53-sgRNA
Plasmid#192162PurposeAAV-TBG-Cre-sgP53-sgRNADepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_NFL(K468TAG)-FLAG
Plasmid#182658PurposeExpresses mouse neurofilament light chain with a TAG codon at the position K468 and a C-terminal FLAG tag (DYKDDDDK) in mammalian cells.DepositorInsertmouse neurofilament light chain with a K468TAG mutation (Nefl Mouse)
TagsFLAG tag (DYKDDDDK)ExpressionMammalianMutationK468TAGPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_NFL(K211TAG)-FLAG
Plasmid#182655PurposeExpresses mouse neurofilament light chain with a TAG codon at the position K211 and a C-terminal FLAG tag (DYKDDDDK) in mammalian cells.DepositorInsertmouse neurofilament light chain with a K211TAG mutation (Nefl Mouse)
TagsFLAG tag (DYKDDDDK)ExpressionMammalianMutationK211TAGPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_NFL(R438TAG)-FLAG
Plasmid#182657PurposeExpresses mouse neurofilament light chain with a TAG codon at the position R438 and a C-terminal FLAG tag (DYKDDDDK) in mammalian cells.DepositorInsertmouse neurofilament light chain with a R438TAG mutation (Nefl Mouse)
TagsFLAG tag (DYKDDDDK)ExpressionMammalianMutationR438TAGPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_NFL linker-3xFLAG KI
Plasmid#182679PurposeExpression of spCas9, gRNA targeting the end of mouse Nefl gene and donor linker-3xFLAG. Can be used for C-terminal tagging of endogenous NFL with a linker-3xFLAG tag.DepositorInsertNefl-targeting gRNA and linker-3xFLAG donor sequence (Nefl Mouse)
ExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_NFL linker(A6TAG)-3xFLAG KI
Plasmid#182680PurposeExpression of spCas9, gRNA targeting the end of mouse Nefl gene and donor linker(A6TAG)-3xFLAG. Can be used for amber codon suppression and click chemistry labeling of endogenous NFL.DepositorInsertNefl-targeting gRNA and linker(A6TAG)-3xFLAG donor sequence (Nefl Mouse)
ExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_FLAG-NFL(K468TAG)
Plasmid#182663PurposeExpresses mouse neurofilament light chain with a TAG codon at the position K468 and an N-terminal FLAG tag (DYKDDDDK) in mammalian cells.DepositorInsertmouse neurofilament light chain with a K468TAG mutation (Nefl Mouse)
TagsFLAG tag (DYKDDDDK)ExpressionMammalianMutationK468TAGPromoterCMVAvailable SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K121R-HA
Plasmid#139852PurposeLentiviral expression of the cDNA indicatedDepositorAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K193R-HA
Plasmid#139857PurposeLentiviral expression of the cDNA indicatedDepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 RR837-8GG
Plasmid#113958Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationresidues 22-839, R837G and R838G substitutionPromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
mouse E-cadherin GFP (423)
Plasmid#67937PurposeMammalian expression of E-cadherin-GFPDepositorAvailable SinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only