We narrowed to 2,572 results for: gem
-
Plasmid#139856PurposeLentiviral expression of human DDRGK1-K176R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pLenti-X1-Neo-DDRGK1-K193R-HA
Plasmid#139857PurposeLentiviral expression of the cDNA indicatedDepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K224R-HA
Plasmid#139858PurposeLentiviral expression of human DDRGK1-K224R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 RR837-8GG
Plasmid#113958Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationresidues 22-839, R837G and R838G substitutionPromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL1-2
Plasmid#109006PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(C128S/D156A)-mCherry
Plasmid#35504PurposeAAV expression of Ef1a-driven, cre-dependent, stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2(C128S/D156A)-mCherry
UseAAVTagsmCherryExpressionMammalianMutationC128S and D156APromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
TVBB N-term-mNeongreen
Plasmid#169226PurposeTargeting vector backbone to support a knock-in of mNeongreen-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mNeongreen
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLIB-HIS-TEV-CKS1
Plasmid#177013PurposeGenerate baculovirus for insect cell expression of CKS1 with N-terminal Polyhistidine-TEVDepositorInsertCKS1 (CKS1B Human, Synthetic)
TagsPolyhistidine-TEVExpressionInsectMutationcodon-optimised for insect cell expressionAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSyn-somBiPOLES-mCerulean
Plasmid#154945PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorInsertsomBiPOLES
UseAAVTagssoma-targeting motif from Kv2.1 channelExpressionMammalianPromoterhuman synapsinAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(C128S/D156A)-EYFP
Plasmid#35503PurposeAAV expression of Ef1a-driven, cre-dependent, stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2(C128S/D156A)-EYFP
UseAAVTagsEYFPExpressionMammalianMutationC128S and D156APromoterEf1aAvailable SinceApril 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-Tq2CFP-OcsT
Plasmid#71268PurposeEntry clone containing Turqoise2. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTq2CFP
UseGatewayTags4xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-GUS-OcsT
Plasmid#71267PurposeEntry clone containing the GUS enzyme. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGatewayTags2xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-Rainbow
Plasmid#206252PurposeExpression of 7 fluorescently labelled proteins in mammalian cells. Can be used to generate recombinant baculovirus particles.DepositorInsertH2B (human); Actin, Tubulin (B. taurus); mito mCherry, GST mTagBFP1 (Synthetic); CyOFP1 (E. quadricolor); Ctnnb1 (mouse)
UseRecombinant baculovirus production (bac-to-bac)TagsiRFP713ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-mScarlet
Plasmid#169219PurposeTargeting vector backbone to support a knock-in of Linker-mScarlet at the C-terminus of a target locusDepositorInsertDouble SapI flanked mScarlet
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-HLA-cmyc-optiT1R3 a21-852
Plasmid#113949Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-852Available SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
TVBB N-term-mTurquoise2
Plasmid#169222PurposeTargeting vector backbone to support a knock-in of mTurquoise2-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mTurquoise2
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
hGFAP-fLuc
Plasmid#40589DepositorInserthGFAP promoter (GFAP Human)
UseLuciferaseTagsFirefly luciferaseMutationContains human GFAP promoter fragment (-2163 to +…PromoterGFAP promoterAvailable SinceSept. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry
Plasmid#35498PurposeAAV expression of Ef1a-driven, cre-dependent, chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.DepositorInsertChR1-VChR1 Chimera
UseAAVTagsmCherryExpressionMammalianMutationE122T and E162TPromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HLA-cMyc-EcopT1R1
Plasmid#113962Purposemammalian expression plasmid for c-myc-tagged E. coli codon-optimized human T1R1 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R1 (TAS1R1 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationtruncate N-terminal 24 residuesAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only