We narrowed to 1,789 results for: plasmid for e coli
-
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Magenta
Plasmid#160446PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Magenta chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Magenta
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a_LolT_C41S
Plasmid#211789PurposeExpression plasmid in E. coli BL21(DE3) , which can be used for expression and purification to get protein LolT_C41SDepositorInsertlolt mutant
TagsHis tagExpressionBacterialPromoterT7 promoterAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEPQDKN0248
Plasmid#162313PurposeReporter plasmid for T7-driven E. coli cell-free protein synthesis with detection via HiBiTDepositorInsertT7prom-RBS-sfGFP-HiBiT
UseSynthetic BiologyAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Pink
Plasmid#160445PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Pink chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Pink
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0245
Plasmid#162284PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-CCAT. Generates plasmids for T7-driven E. coli cell-free protein synthesisDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQDKN0729
Plasmid#162316PurposeTEV protease plasmid for T7-driven E. coli cell-free protein synthesisDepositorInsertT7prom-RBS-NET-TEVprotease
UseSynthetic BiologyAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Orange
Plasmid#160444PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Orange chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Orange
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPMY1CB0001
Plasmid#162317PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-CCAT. Generates plasmids for T7-driven expression in E. coli. Contains mRFP1 reporter.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0025
Plasmid#162283PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-AATG. Generates plasmids for T7-driven E. coli cell-free protein synthesisDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-MCN-10His-mStayGold (E138D)
Plasmid#211361PurposeBacterial expression of the bright and photostable monomeric StayGold fluorescent protein (E138D). Codon optimised for expression in Escherichia coli. Contains a N-terminal 10xHis tag.DepositorInsertmStayGold
Tags10xHis-tagExpressionBacterialMutationE138DPromoterT7Available SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70DA9-Pct5-DadhABC(A2)
Plasmid#191632PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strainDepositorInsertDopamine dehydroxylase
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB1alpha2_SulR
Plasmid#186425Purposetranscriptional unit for sulfadiazine resistance; plant expression driven by the Pnos promoterDepositorInsertSulR
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadH)-Pdadh-DadhABC(A2)
Plasmid#191644PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), native promoter-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strainDepositorInsertDopamine dehydroxylase
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pProUSER13F4C
Plasmid#178023PurposeE. coli - B. subtilis nicking vector pProUSER13F4C. Ap-BBR1; ΔsigF-insertion-site; Km; manR-PmanADepositorInsertnicking site to be replaced with your gene of interest
ExpressionBacterialPromoterPmanAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pProUSER13E3F
Plasmid#178026PurposeE. coli - B. subtilis nicking vector pProUSER13E3F. Ap-BBR1; yhgE-insertion-site; Spc; tetR-PtetDepositorInsertnicking site to be replaced with your gene of interest
ExpressionBacterialPromoterPtetAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pProUSER13G2F
Plasmid#178027PurposeE. coli - B. subtilis nicking vector pProUSER13G2F . Ap-BBR1; rsbP-insertion-site; Ery; tetR-PtetDepositorInsertnicking site to be replaced with your gene of interest
ExpressionBacterialPromoterPtetAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-ARL3
Plasmid#67376PurposeExpression of native hArl3 in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
hisSUMO-ZFP57
Plasmid#102716PurposeExpress DNA binding domain of human Zinc finger protein 57 in E. coliDepositorAvailable SinceNov. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-DEST42-SAR1-V5-His6
Plasmid#67430PurposeExpression of hSar1 with C-term V5 and His6 tag in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only