We narrowed to 9,067 results for: sgRNA
-
Plasmid#181909PurposeSingle guide RNA with 2XMS2 loops targeting bacterial lac operatorDepositorInsertsgRNA-2XMS2-lacO
UseCRISPRExpressionMammalianPromoterU6Available sinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
psgRNA-2xMS2-mSAT
Plasmid#181908PurposeSingle guide RNA with 2XMS2 loops targeting mouse major satellite repeatsDepositorInsertsgRNA-2XMS2-mSAT
UseCRISPRExpressionMammalianPromoterU6Available sinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgACO1_3
Plasmid#169893PurposeDisrupt ACO1DepositorInsertsgRNA targeting ACO1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCZGY2750
Plasmid#135094PurposeSite specific CRISPR/Cas9 editing of C. elegans Chr IVDepositorInsertsgRNA for cxTi10082 (actgttggatgcctgtgtag)
UseCRISPRExpressionWormPromoterU6Available sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MTK234_047
Plasmid#124055PurposeEncodes the spCas9 mScarlet (site 2) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertmScarlet sgRNA 2
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_048
Plasmid#124056PurposeEncodes the spCas9 mScarlet (site 3) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertmScarlet sgRNA 3
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_049
Plasmid#124057PurposeEncodes the spCas9 mScarlet (site 4) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertmScarlet sgRNA 4
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_050
Plasmid#123918PurposeEncodes the saCas9 gRNA GFP dropout expression cassette as a type 234 part to be used in the MTK systemDepositorInsertSaCas9-sgRNA-GFPDROPOUT
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_051
Plasmid#123919PurposeEncodes the saCas9 UAS (miniCMV core) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertpUAS sgRNA (Sa)
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-SYNJ2BP-1
Plasmid#92159PurposeCRISPR guide RNA targeting human SYNJ2BPDepositorInsertSYNJ2BP sgRNA-1
UseCRISPR and LentiviralExpressionMammalianPromoterhU6AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-SYNJ2BP-2
Plasmid#92160PurposeCRISPR guide RNA targeting human SYNJ2BPDepositorInsertSYNJ2BP sgRNA-2
UseCRISPR and LentiviralExpressionMammalianPromoterhU6AvailabilityAcademic Institutions and Nonprofits only -
pSEM254 - sgRNA mosTI neoR
Plasmid#159831PurposeSingle copy or array insertion by MosTI using split NeoR selectionDepositorInsertsgRNA mosTI neoR
ExpressionWormMutationNot applicableAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC572
Plasmid#62318PurposesgRNA with 1x com for yeast cellsDepositorInsertsgRNA + 1x com RNA binding module
ExpressionYeastPromoterSNR52Available sinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330_NPM2_cterm1
Plasmid#222911PurposeCas9/sgRNA plasmid for targeting NPM2DepositorPublicationInsertCas9, NPM2 sgRNA 1 (NPM2 Synthetic, Human)
UseCRISPRAvailable sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm4
Plasmid#222914PurposeCas9/sgRNA plasmid for targeting NPM2DepositorPublicationInsertCas9, NPM2 sgRNA 4 (NPM2 Synthetic, Human)
UseCRISPRAvailable sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm3
Plasmid#222913PurposeCas9/sgRNA plasmid for targeting NPM2DepositorPublicationInsertCas9, NPM2 sgRNA 3 (NPM2 Synthetic, Human)
UseCRISPRAvailable sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm2
Plasmid#222912PurposeCas9/sgRNA plasmid for targeting NPM2DepositorPublicationInsertCas9, NPM2 sgRNA 2 (NPM2 Synthetic, Human)
UseCRISPRAvailable sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorPublicationAvailable sinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorPublicationAvailable sinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGuide-P1-O1a (EL702)
Plasmid#140040PurposeCRISPR DuMPLING negative control plasmid with probe/barcode P1 and negative control lacO1array spacer in the sgRNA. Also template for library PCRs.DepositorInsertbarcode P1 and sgRNA lacO1 array
UseSynthetic BiologyAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only