We narrowed to 10,184 results for: tre promoter
-
Plasmid#135554PurposeExpress rat Munc18b in Sf9 cells, the resulted plasmid encodes an N-terminally His6-tagged Munc18c protein with a tobacco etch virus (TEV) cleavage site between the His6 tag and Munc18b.DepositorInsertMunc18b (Stxbp2 Rat)
Tags6xHis tag and TEV siteExpressionInsectPromoterpolyhedrin promoterAvailable SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
cARA12-mRFP
Plasmid#181961PurposeARA12 protein tagged with mRFP, under control of TBA2 promoterDepositorAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJL3
Plasmid#184131PurposeFor rescuing null mrp-1 mutation and labelling mrp-1 protein. Intestinal specific Pges-1 promoter drives MRP-1 expression. Translational fusion construct. pPD95.75_Pges-1::mrp-1(isoform C cDNA)::gfp.DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJC20-Tpm4.2 (Rn)
Plasmid#99359PurposeBacterial expression vector containing cDNA encoding for the Rattus norvegicus tropomyosin, Tpm4.2 under the control of the pRhamnose promoterDepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
RCAN1-aa1-150
Plasmid#65412PurposeRCAN1 aa1-150 expression with CMV promoter. Flag tagged.DepositorInsertRCAN1-aa1-150 (Rcan1 Mouse)
TagsFlagExpressionMammalianMutationaa1-150 present, deleted 151 to endAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2(miRE.FF4)-TS.FF6x1-bGH
Plasmid#235297PurposeComMAND open-loop circuit regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235298PurposeComMAND closed-loop circuit regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2-bGH
Plasmid#235296PurposeComMAND base gene regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only