We narrowed to 8,732 results for: sgRNA
-
Plasmid#159824PurposeSingle copy or array insertion by MosTI using split unc-119 selectionDepositorInsertsgRNA mosTI unc-119 array insertion
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
lenti U6-sgRNA-acRNA SYN-dCas9-P2A-EGFP
Plasmid#159086PurposeExpresses dCas9-P2A-EGFP driven by human SYN promoter and empty CRISPR Display sgRNA/accessory RNA from U6 promoter.DepositorInsertempty crRNA-acRNA backbone, dCas9-P2A-EGFP
UseCRISPR and LentiviralTagsEGFP and FLAGExpressionMammalianPromoterhSYN, U6Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-human U6-sgRNA-EF1Alpha-puro-T2A-BFP
Plasmid#118594PurposeParental vector for the CRISPRa libraries. Expresses an sgRNA from the human U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoterDepositorInsertsgRNA/Puro-T2A-BFP
UseLentiviralExpressionMammalianPromoterEF1AlphaAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pM125: pAAV-EFS-CasRx-VEGFA array presgRNA
Plasmid#166873PurposeAAV vector for expressing CasRx and human VEGFA targeting presgRNA array for RNA-editingDepositorInsertsU6-VEGFA array presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianPromoterEFS and U6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-ABE-3'UTR-sgRNA-ST2-com vector
Plasmid#136270PurposeExpresses ABE and ST2-com modified sgRNA scaffoldDepositorInsertABE and sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-ABE-3'UTR-sgRNA-Tetra-com-vector
Plasmid#132560PurposeVector plasmid expressing ABEmax and sgRNA scaffold with com replacing the Tetraloop.DepositorInsertsABEmax
sgRNA, with Tetraloop replaced by com aptamer
ExpressionMammalianPromoterCMVAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 N. meningitidis sgRNA BfuAI large stuffer
Plasmid#86195PurposeU6 based expression of N meningitidis sgRNADepositorInsertnmCas9 sgRNA cloning cassete
UseLentiviralPromoterU6Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgRNA-Dual_filler(hU6_H1)-EF1a-Thy1.1-P2A-Neo
Plasmid#239608PurposeBackbone for the cloning of a dual sgRNA expression plasmid (hU6 and H1 promoters) using BsmbI. Selectable with a G418 resistanceDepositorInsertfiller-trcr-H1-filler
UseCRISPR and LentiviralAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-EGFP-W3SL_BbsI(GGA)
Plasmid#231367PurposePle155-driven EGFP, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-mRuby2-W3SL_BbsI(GGA)
Plasmid#231368PurposePle155-driven mRuby2, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertmRuby2
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
p104Tol2-tp1:Cas9-t2A-GFP, 4xU6:sgRNA
Plasmid#227773PurposeExpression of tp1 (Notch) dependent Cas9-GFP and U6-driven 4 sgRNAs in zebrafishDepositorInsertsCas9-t2A-GFP
4xU6:sgRNA
UseCRISPRPromoterU6 and tp1Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
Plasmid#177360PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expression from Synapsin promoterDepositorInsertstdTomato
Chimeric guide for SaCas9
UseAAVTagsP2A and a tetracycline-controlled transactivator …ExpressionMammalianPromoterSynapsine promoter and U6 promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
Plasmid#177365PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expressionDepositorInsertstdTomato
Chimeric guide for SaCas9
UseAAVTagsP2A and a tetracycline-controlled transactivator …ExpressionMammalianPromoterCMV and U6 promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-nick sgRNA
Plasmid#214101PurposeLentiviral vector expressing nicking sgRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two sgRNAs using independent U6 promoters.DepositorInsertEGFR L858R nicking sgRNA/EGFR T790M nicking sgRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-inteinC-aa713 SpG C-U6- sgRNA scaffold
Plasmid#208111PurposeExpresses SpG cas9C by the constitutive CASI promoter and sgRNA scaffold by U6 promoterDepositorInsertSpG C, U6, scaffold
UseAAVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-InteinC-NG C aa714-1368-U6-Lmna sgRNA1
Plasmid#206974PurposeExpresses NG cas9C by the constitutive CASI promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertNG aa714-1368, U6, Lmna sgRNA1
UseAAVPromoterU6Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-recipient_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211688PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and guide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1(D908A)-2A-GFP-U6-sgRNA-cloning vector
Plasmid#194726PurposeCAGGS-AsCpf1(D908A)-2A-GFP-U6-sgRNA-cloning vectorDepositorArticleInsertAsCpf1(D908A)
UseCRISPRExpressionMammalianMutationD908AAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA:scaffold tetraloop MS2 aptamer SAM (GB1436)
Plasmid#160570PurposeA version of scaffold sgRNA with the sequence of MS2 aptamer inside the tetraloop of the scaffoldDepositorInsertsgRNA:scaffold tetraloop MS2 aptamer SAM
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only