We narrowed to 26,843 results for: tat
-
Plasmid#116446PurposeLentiviral expression of OXA1L P58SDepositorInsertOXA1L (OXA1L Human)
UseLentiviralTagsExpressionMutationP58SPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP V107M-L273D-L276D
Plasmid#114183PurposeORAI1 channel with C-terminal YFP, carrying the constitutively activating mutation V107M from TAM, and the mutations L273D-L276D leading to a deficiency in STIM1-mediated gating.DepositorInsertORAI1-YFP V107M-L273D-L276D (ORAI1 Human)
UseTagsYFPExpressionMammalianMutationV107M/L273D/L276DPromoterAvailable sinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP T184M-L273D-L276D
Plasmid#114184PurposeORAI1 channel with C-terminal YFP, carrying the activating mutation T184M from TAM, and the mutations L273D-L276D leading to a deficiency in STIM1-mediated gating.DepositorInsertORAI1-YFP T184M-L273D-L276D (ORAI1 Human)
UseTagsYFPExpressionMammalianMutationT184M/L273D/L276DPromoterAvailable sinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_VPEVS
Plasmid#105863PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
UseTagsExpressionMammalianMutationmutated heavy chain of mouse IgG3 with five mutat…PromoterhEF1-HTLV promAvailable sinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_ILGGP
Plasmid#105855PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
UseTagsExpressionMammalianMutationmutated heavy chain of mouse IgG1 with five mutat…PromoterhEF1-HTLV promAvailable sinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH2charge
Plasmid#105852PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. Introduced mutations modify charge of CH2 domain.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
UseTagsExpressionMammalianMutationmutated heavy chain of mouse IgG1, muatations: Gl…PromoterhEF1-HTLV promAvailable sinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100/125/147L-siResist
Plasmid#49856PurposeEncodes human connexin 43 with M100, M125, and M147 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
UseTagsExpressionMammalianMutationMethionine100, Methionine 125, and Methionine 147…PromoterCMVAvailable sinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100/125L-siResist
Plasmid#49855PurposeEncodes human connexin 43 with M100 and M125 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
UseTagsExpressionMammalianMutationMethionine100 and Methionine 125 mutated to Leuci…PromoterCMVAvailable sinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TGFBR2
Plasmid#116800PurposeLentiviral expression of TGFBR2DepositorInsertTGFBR2 (TGFBR2 Human)
UseLentiviralTagsExpressionMutationWTPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3CA
Plasmid#116771PurposeLentiviral expression of PIK3CADepositorInsertPIK3CA (PIK3CA Human)
UseLentiviralTagsExpressionMutationWTPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG-Cas9-T2A-EGFP-ires-puro
Plasmid#78311PurposeExpresses WT SpCas9, EGFP and Puromycin resistance from a CAG promoter.DepositorInsertWT SpCas9-T2A-EGFP-ires-puromycin resistance
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianMutationPromoterCAGAvailable sinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDF-hLPYK
Plasmid#220231PurposeInducible expression of human liver pyruvate kinaseDepositorInsertHuman liver pyruvate kinase (PKLR Human)
UseTagsExpressionBacterialMutationPromoterT7Available sinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTEN
Plasmid#116780PurposeLentiviral expression of PTENDepositorInsertPTEN (PTEN Human)
UseLentiviralTagsExpressionMutationWTPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PDGFRB
Plasmid#116770PurposeLentiviral expression of PDGFRBDepositorInsertPDGFRB (PDGFRB Human)
UseLentiviralTagsExpressionMutationWTPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pHAGE-PIK3CG
Plasmid#116774PurposeLentiviral expression of PIK3CGDepositorInsertPIK3CG (PIK3CG Human)
UseLentiviralTagsExpressionMutationWTPromoterAvailable sinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_DED/AAA USP7
Plasmid#131253PurposeMammalian expression of an N-terminally Myc-tagged USP7 mutant, with mutations in UBL2 (DE758AA_D764A)DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
UseTagsMycExpressionMammalianMutationContains point mutations that convert USP7 aspart…PromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3CD-E1021K
Plasmid#116566PurposeLentiviral expression of PIK3CD E1021KDepositorInsertPIK3CD (PIK3CD Human)
UseLentiviralTagsExpressionMutationE1021KPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -