We narrowed to 28,253 results for: tat
-
Plasmid#222616PurposeExpresses a form of full length SRGAP2 with one point mutation (W765A) in the SH3 domain abrogating its ability to bind to Gephyrin.DepositorInsertSRGAP2 (SRGAP2 Human)
TagsEGFPExpressionMammalianMutationPoint mutation W765A (SH3 domain)Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG_SRGAP2A_SH3(W765A)_HA
Plasmid#222614PurposeExpresses a form of full length SRGAP2 with one point mutation (W765A) in the SH3 domain abrogating its ability to bind to Gephyrin.DepositorInsertSRGAP2 (SRGAP2 Human)
TagsHAExpressionMammalianMutationPoint mutation W765A (SH3 domain)Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG SRGAP2A_EVH1(P339L F342C)
Plasmid#222613PurposeExpresses a form of full length SRGAP2 with two point mutations (P339L and F342C) that abrogate EVH1 binding site for Homer1DepositorInsertSRGAP2 (SRGAP2 Human)
TagsEGFPExpressionMammalianMutationPoint mutations P339L and F342CAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCapVQ329R
Plasmid#183029Purposethe patatin-like phosphodiesterase CapV variant CapVQ329R cloned in the L-arabinose inducible vector pBAD28DepositorInsertpatatin-like phospholipase variant CapVQ329R
TagsNoExpressionBacterialMutationglutamine 329 changed to argininePromoterpBAD promoterAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_2
Plasmid#155066PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_4
Plasmid#155076PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PHF21A__CAMK1D
Plasmid#116831PurposeLentiviral expression of PHF21A__CAMK1D fusionDepositorInsertPHF21A__CAMK1D
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PRKCE__CAMKMT
Plasmid#116832PurposeLentiviral expression of PRKCE__CAMKMT fusionDepositorInsertPRKCE__CAMKMT
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTK2__NCR3
Plasmid#116834PurposeLentiviral expression of PTK2__NCR3 fusionDepositorInsertPTK2__NCR3
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-QKI__PACRG
Plasmid#116835PurposeLentiviral expression of QKI__PACRG fusionDepositorInsertQKI__PACRG
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CDK6__HEPACAM2
Plasmid#116812PurposeLentiviral expression of CDK6__HEPACAM2 fusionDepositorInsertCDK6__HEPACAM2
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-DUSP22__PTK7
Plasmid#116814PurposeLentiviral expression of DUSP22__PTK7 fusionDepositorInsertDUSP22__PTK7
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-GSK3A__ZNF564
Plasmid#116820PurposeLentiviral expression of GSK3A__ZNF564 fusionDepositorInsertGSK3A__ZNF564
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IDE__CAMK1D
Plasmid#116823PurposeLentiviral expression of IDE__CAMK1D fusionDepositorInsertIDE__CAMK1D
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IKBKB__ANK1
Plasmid#116824PurposeLentiviral expression of IKBKB__ANK1 fusionDepositorInsertIKBKB__ANK1
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-MAP2K5__IQCH
Plasmid#116826PurposeLentiviral expression of MAP2K5__IQCH fusionDepositorInsertMAP2K5__IQCH
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_CH2charge
Plasmid#105858PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. Introduced mutatnions modify charge of CH2 domain.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG3, muatations: Hi…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
xCIAR_pcDNA5/FRT/TO
Plasmid#86504PurposeExpresses inactive control CIAR (xCIAR) in mammalian cells. Used to generate Flp-In stables.DepositorInsertxCIAR (SOS1 Human)
UseFrtExpressionMammalianMutationF929A and T968L in SOScatPromoterCMV (tet operator)Available SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100L-siResist
Plasmid#49854PurposeEncodes human connexin 43 with M100 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationMethionine100 mutated to Leucine. Contains severa…PromoterCMVAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only