We narrowed to 19,779 results for: INO
-
Plasmid#58422Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant human IRE1a deleted from amino acids P28 to D408DepositorInsertIRE1a (ERN1 Human)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationDeleted amino acids P29 to D408Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSPL3-hRPH3A_c.444Gwt
Plasmid#190476Purposeminigene assayDepositorInsertRPH3A (NM_014954.3) c.444 [exon 7 and part of surrounding introns only] (RPH3A Human)
ExpressionMammalianPromoterSV40Available SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBabe.puro.CDK8.flag
Plasmid#19758DepositorAvailable SinceDec. 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3F
Plasmid#224447PurposeRep/Cap plasmid for the production of MyoAAV 3F, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDHASW insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3A
Plasmid#224442PurposeRep/Cap plasmid for the production of MyoAAV 3A, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYVGL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-Phi29 (JO582)
Plasmid#208954PurposeA variant CE1 construct with Phi29 DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-Phi29(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A), Phi29(-exo;D169A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS2181
Plasmid#158421PurposeAAV plasmid with Ple32 (CLDN5 MiniPromoter) driving expression of EmGFP. Contains WPRE.DepositorAvailable SinceFeb. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSH-Csy4-T2A-SpRFN
Plasmid#85754PurposeExpresses S. pyogenes FokI-dCas9-NLS with a 25 amino acid linker (GGGGS)5 fusion. Also expresses Csy4 for cleavage of multiplexed gRNA transcripts. Derived from pSQT1601 (Addgene #53369).DepositorInsertCsy4-T2A-FokI-dCas9
UseCRISPRTagsCsy4 and FokI fusion via 25 amino acid (GGGGS)5 l…ExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only