We narrowed to 82,999 results for: Mycs
-
Plasmid#15408DepositorAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only
-
pET29b(+)_SUMO(1-98)_sTEV_His6
Plasmid#254139PurposePlasmid for expressing Control protein construct of the AH-SUMO platfrom, without any N-terminal inducible amphipathic helix.DepositorInsertSUMO family protein SMT3 (SMT3 Budding Yeast)
ExpressionBacterialMutationContains MGSGS sequence on N-terminal of SMT3_yea…Available SinceApril 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT6-V5H6.MCh.Puro
Plasmid#209944PurposeIn mammalian cells expresses TP fused to a CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 6 (CNOT6 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPD1178-LPDV promoterless PuroR-P2A-miRFP720
Plasmid#201537PurposeLanding pad destination vector for mMoClo golden gate-based assembly of landing pad integration vectors; contains BxB1 attB site, promoterless puromycin resistance gene and miRFP720 geneDepositorInsertPromoterless PuroR-P2A-miRFP720
ExpressionMammalianPromoterNoneAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-SF14P
Plasmid#209448Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the SF14P promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from SF14P promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-kasOP*
Plasmid#209447Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the kasOP* promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from kasOP* promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
ClhN-P1K-3VSV-Atg8(L55W T56A V61W R65A)-MET15
Plasmid#207054PurposeExpression of 3VSV-Atg8 point mutant. Uses auxotrophic marker MET15(Saccharomyces cerevisiae).DepositorInsertATG8
Tags3xVSVExpressionYeastMutationL55W T56A V61W R65AAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-NUbo-E3(48)-mCherry-P2A-3xFLAG-Ubc7
Plasmid#212805PurposeConstitutive or doxycycline-inducible expression of NUbo-E3(48)-mCherry-P2A-3xFLAG-Ubc7 in mammalian cellsDepositorInsertNUbo-E3(48)-mCherry-P2A-3xFLAG-Ubc7
ExpressionMammalianAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only