We narrowed to 4,396 results for: Erf

#117159

Target site AATTATCACAAAGAGGACAGG

Jeremy Luban

McCauley et al Nat Commun. 2018 Dec 13;9(1):5305. doi:

March 14, 2019

Academic Institutions and Nonprofits only

#117157

Target site TATTTCCCTGTCTCCTTGGCC

Jeremy Luban

McCauley et al Nat Commun. 2018 Dec 13;9(1):5305. doi:

March 14, 2019

Academic Institutions and Nonprofits only

#117158

Target site ATAAGGAAGCACTCGATGTCG

Jeremy Luban

McCauley et al Nat Commun. 2018 Dec 13;9(1):5305. doi:

March 14, 2019

Academic Institutions and Nonprofits only

#186533

Monomeric hyperfolder YFP fluorescent protein: cytosolic expression in mammalian cells

Gregory Petsko

Campbell et al Nat Methods. 2022 Nov 7. pii: 10.1038/s4

Nov. 8, 2022

Academic Institutions and Nonprofits only

#12247

2nd gen lentivector expressing shRNA from H1 promoter and GFP. For direct cloning of shRNA or sub-cloning of an H1-shRNA cassette from pSUPER. Dox-controllable if used with tTRKRAB expressing plasmid

Didier Trono

Wiznerowicz et al J Virol. 2003 Aug . 77(16):8957-61.

Aug. 4, 2006

Academic Institutions and Nonprofits only

#181824

This vector simultaneously expresses GFP protein and shRNA in a Cre-dependent manner.

Eun Mi Hwang

Kim et al J Neurosci Methods. 2021 Dec 21:109452.

May 20, 2022

Academic Institutions and Nonprofits only

#227390

Adhesion module, scFv binds SunTag

Clifford Brangwynne

Strom et al Cell. 2024 Aug 14:S0092-8674(24)00828-6.

Oct. 24, 2024

Academic Institutions and Nonprofits only

#10957

Michael Gottesman

Pastan et al Proc Natl Acad Sci U S A. 1988 Jun . 85(

March 14, 2006

Academic Institutions and Nonprofits only

#227377

Condensate module, light-inducible oligomerization IDR

Clifford Brangwynne

Strom et al Cell. 2024 Aug 14:S0092-8674(24)00828-6.

Oct. 24, 2024

Academic Institutions and Nonprofits only