We narrowed to 329 results for: 10B
-
Plasmid#154961Purposeencodes transcriptional reporter of SMAD2/3DepositorInsertmScarlet
UsePiggybacTagsNLS-PESTExpressionMammalianAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL2-Full
Plasmid#16012DepositorAvailable SinceNov. 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-TCL
Plasmid#23231DepositorAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTCW007
Plasmid#83525Purposepheromone mediated alpha pheromone expression in yeast from the mfalpha 1 gene and FUSJ2 promoterDepositorInsertpFUS1J2-mfalpha1
ExpressionYeastPromoterpFUS1J2Available SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTCW008
Plasmid#83526Purposepheromone mediated alpha pheromone expression in yeast from the mfalpha 2 gene and FUSJ2 promoterDepositorInsertpFUS1J2-mfalpha2
ExpressionYeastPromoterpFUS1J2Available SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTCW010
Plasmid#83521PurposeAromatic amino acid inducible expression of alpha pheromone in yeast from the mfalpha2 geneDepositorInsertpARO9-mfalpha2
ExpressionYeastPromoterpARO9Available SinceDec. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTCW009
Plasmid#83523PurposeAromatic amino acid inducible expression of alpha pheromone in yeast from the mfalpha1 geneDepositorInsertpARO9-mfalpha1
ExpressionYeastPromoterpARO9Available SinceDec. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTCW005
Plasmid#83524Purposepheromone mediated alpha pheromone expression in yeast from the mfalpha 1 geneDepositorInsertpFUS1-malpha1
ExpressionYeastPromoterpFUS1Available SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Tet1
Plasmid#60938PurposeExpresses Tet1 in mammalian cellsDepositorAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTrc-trGPPS(CO)-LS
Plasmid#50603PurposepTrc-trGPPS(CO)-LS: A plasmid that has truncated codon optimized geranylpyrophosphate synthase and truncated limonene synthaseDepositorInsertsLimonene Synthase
ApR
LacIq
UseSynthetic BiologyExpressionBacterialMutationtruncated codon optimized geranylpyrophosphate sy…PromoterTrcAvailable SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pH3U3-zif268 (omega)
Plasmid#18046DepositorInsertzif268 binding site
ExpressionBacterialMutationThe preferred binding site for zif268 is inserted…Available SinceJune 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
Myc-CICf
Plasmid#48185PurposeExpresses CicDepositorAvailable SinceOct. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKin1A
Plasmid#31607DepositorAvailable SinceOct. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pR6Kg-Alpha1
Plasmid#165862PurposeAlpha level R6K_ origin GB Cloning vector, Conditionally replicative ori, requires pir gene expression requires EC100D or EC100D116 bacterial strain (DH10B derived) uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pR6Kg-Omega1
Plasmid#165864PurposeOmega level R6K_ origin GB Cloning vector, Conditionally replicative ori, requires pir gene expression requires pir gene expression requires EC100D or EC100D116 bacterial strain (DH10B derived)DepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUAS-hopscotch
Plasmid#37301DepositorAvailable SinceJuly 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
Myc-CICf_L40S
Plasmid#48187PurposeExpresses L40S mutated CicDepositorAvailable SinceOct. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
Myc-CICf_W37A
Plasmid#48186PurposeExpresses W37A mutated CicDepositorAvailable SinceOct. 4, 2013AvailabilityAcademic Institutions and Nonprofits only