We narrowed to 834 results for: chm
-
Plasmid#154183Purposeexpresses squirrel monkey CHMP3(155) in mammalian cellsDepositorInsertCHMP3(155)
TagsFLAG, Strep-Tag II, and preScission siteExpressionMammalianMutationC-terminal truncation of CHMP3 at amino acid 155Available sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CHMP2A-myc, L216D/L219D
Plasmid#180645PurposeMammalian expression of CHMP2A with L216D/L219D mutations. Has C-terminal Myc tag. Internal ID:WISP20-13.DepositorAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-woolly-monkey-retroCHMP3(148)-HA
Plasmid#154250Purposeexpresses prematurely truncated woolly monkey retroCHMP3 in mammalian cellsDepositorInsertretroCHMP3
TagsHAExpressionMammalianMutationC-terminal truncation of retroCHMP3 at amino acid…PromoterEF1-alphaAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-pygmy-marmoset-retroCHMP3(148)-HA
Plasmid#154251Purposeexpresses prematurely truncated pygmy marmoset retroCHMP3 in mammalian cellsDepositorInsertretroCHMP3
TagsHAExpressionMammalianMutationC-terminal truncation of retroCHMP3 at amino acid…PromoterEF1-alphaAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 186-199
Plasmid#108285PurposeExpresses residues 186-199 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-283DepositorAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 144-178
Plasmid#108287PurposeExpresses residues 144-178 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-281DepositorAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV(WT)-mouse-full-length-CHMP3-HA
Plasmid#154175Purposeexpresses mouse CHMP3 in mammalian cellsDepositorAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-PP-squirrel-monkey-CHMP3
Plasmid#154182Purposeexpresses squirrel monkey CHMP3 in mammalian cellsDepositorInsertCHMP3
TagsFLAG, Strep-Tag II, and preScission siteExpressionMammalianPromoterCAGAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-PP-squirrel-monkey-retroCHMP3
Plasmid#154184Purposeexpresses squirrel monkey retroCHMP3 in mammalian cellsDepositorInsertretroCHMP3
TagsFLAG, Strep-Tag II, and preScission siteExpressionMammalianPromoterCAGAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-d10-52-3xHA (Δα1)
Plasmid#232004PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with the first alpha helix deleted with a 3xHA tag.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCHMP2B (CHMP2B Human)
Tags3xHAExpressionMammalianMutationL4D F5D Δ10-52Available sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-d55-96-3xHA (Δα2)
Plasmid#232005PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with the second alpha helix deleted with a 3xHA tag.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCHMP2B (CHMP2B Human)
Tags3xHAExpressionMammalianMutationL4D F5D Δ55-96Available sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-squirrel-monkey-retroCHMP3-T2A-H2B-BFP
Plasmid#154185Purposeexpresses squirrel monkey retroCHMP3 with self-cleaving tag in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertretroCHMP3
TagsHA and T2A-H2B-BFPExpressionMammalianPromoterEF1-alphaAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
GST-CHMP4A (205-222) E209A (pGEX2T(TEV))
Plasmid#80640PurposeResidues 205-222 of CHMP4A, Mutation modestly disrupts binding to ALIX; Bacterial Expression Vector; TEV-cleavable GST-tag; Sundquist Lab Internal ID: WISP06-206DepositorInsertCHMP4A (CHMP4A Human)
TagsGSTExpressionBacterialMutationChanged Glutamate 209 to alanineAvailable sinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP4B, residues 156-224, no Cys
Plasmid#180641PurposeBacterial expression for CHMP4B C-terminal tail, residues 156-224. Used for FP competition experiments. Has N-terminal HIS-SUMO tag. Internal ID: WISP20-140DepositorInsertCHMP4B (CHMP4B Human)
TagsHIS-SUMOExpressionBacterialMutationResidues 156-224PromoterT7Available sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP4C, residues 156-233, no Cys
Plasmid#180642PurposeBacterial expression for CHMP4C C-terminal tail, residues 156-233. Used for FP competition experiments. Has N-terminal HIS-SUMO tag. Internal ID: WISP20-14.DepositorInsertCHMP4C (CHMP4C Human)
TagsHIS-SUMOExpressionBacterialMutationresidues 316-366PromoterT7Available sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB1-ΔN-CHMP4C(S191C,I225A,L228A,W231A)
Plasmid#199242PurposeCodon-optimized bacterial expression plasmid. Expresses GB1-His6-TEV-CHMP4C(121-233, S191C,I225A,L228A,W231A)DepositorInsertGB1-His6-TEV-CHMP4C(121-233, S191C, I225A, L228A, W231A) (CHMP4C Human)
TagsGB1-His6-TEVExpressionBacterialMutationS191C, I225A, L228A, W231AAvailable sinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 4-199 L188A/L192A
Plasmid#108289PurposeExpresses residues 4-199 with L to A mutations at residues 188 and 192 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-284DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 188 to A, changed L 192 to AAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 4-199 L192A/L195A
Plasmid#108291PurposeExpresses residues 4-199 with L to A mutations at residues 192 and 195 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-285DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 192 to A, changed L 195 to AAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV(Δ3)-squirrel-monkey-full-length-CHMP3-HA
Plasmid#154169Purposeexpresses squirrel monkey CHMP3 in mammalian cellsDepositorInsertCHMP3
TagsHAExpressionMammalianPromoterCMVAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only