We narrowed to 327 results for: gpi
-
Plasmid#71985PurposeExpresses the extracellular region of the Netrin G1, isoform b protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNtng1.b (Ntng1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.h-AP-His
Plasmid#71991PurposeExpresses the extracellular region of the Netrin G1, isoform h protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNtng1.h (Ntng1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.e-AP-His
Plasmid#71988PurposeExpresses the extracellular region of the Netrin G1, isoform e protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNtng1.e (Ntng1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.j-AP-His
Plasmid#71993PurposeExpresses the extracellular region of the Netrin G1, isoform j protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNtng1.j (Ntng1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn1-Fc-His
Plasmid#72065PurposeExpresses the extracellular region of the Contactin 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertCntn1 (Cntn1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn2-Fc-His
Plasmid#72066PurposeExpresses the extracellular region of the Contactin 2 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertCntn2 (Cntn2 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn1-AP-His
Plasmid#71939PurposeExpresses the extracellular region of the Contactin 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn1 (Cntn1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn2-AP-His
Plasmid#71940PurposeExpresses the extracellular region of the Contactin 2 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn2 (Cntn2 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn5.1-AP-His
Plasmid#71943PurposeExpresses the extracellular region of the Contactin 5, isoform 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn5.1 (Cntn5 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn5.1-Fc-His
Plasmid#72069PurposeExpresses the extracellular region of the Contactin 5, isoform 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertCntn5.1 (Cntn5 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn6-AP-His
Plasmid#71944PurposeExpresses the extracellular region of the Contactin 6 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn6 (Cntn6 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn3-Fc-His
Plasmid#72067PurposeExpresses the extracellular region of the Contactin 3 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertCntn3 (Cntn3 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-3'UTR
Plasmid#136055PurposeCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)DepositorInsertCAPRIN1 (CAPRIN1 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-CDS
Plasmid#136054PurposeCAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT)DepositorInsertCAPRIN1 (CAPRIN1 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-CAPRIN1-ts1
Plasmid#174229PurposeCAPRIN1 knockdownDepositorInsertCAPRIN1 shRNA (CAPRIN1 Human)
UseLentiviral and RNAiTagsExpressionMutationPromoterSFFVAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-CAPRIN1-ts2
Plasmid#174230PurposeCAPRIN1 knockdownDepositorInsertCAPRIN1 shRNA (CAPRIN1 Human)
UseLentiviral and RNAiTagsExpressionMutationPromoterSFFVAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-CAPRIN1-ts3
Plasmid#174231PurposeCAPRIN1 knockdownDepositorInsertCAPRIN1 shRNA (CAPRIN1 Human)
UseLentiviral and RNAiTagsExpressionMutationPromoterSFFVAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-mEmerald-CAPRIN1
Plasmid#164218PurposeExpresses mEmerald tagged CAPRIN1 under EF-1a promoterDepositorInsertCAPRIN1 (CAPRIN1 Human)
UseLentiviralTagsmEmeraldExpressionMutationPromoterEF-1aAvailable sinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
m168
Plasmid#34886DepositorInsertSindbis virus envelope protein
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceSept. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1(+)-myc-SNAP-GP135
Plasmid#50376PurposeExpress myc and SNAP-tagged GP135 in mammmalian cellsDepositorInsertSNAP
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only