We narrowed to 6,371 results for: siae

#87405

p426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#195041

pFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interference

Gloria Brar

Powers et al Elife. 2022 Dec 12;11:e81086. doi: 10.75

Feb. 9, 2023

Academic Institutions and Nonprofits only

#195040

pFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interference

Gloria Brar

Powers et al Elife. 2022 Dec 12;11:e81086. doi: 10.75

Feb. 9, 2023

Academic Institutions and Nonprofits only

#87409

p426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87408

p426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#35116

John McCusker

Ito-Harashima et al Yeast. 2004 Jan 15;21(1):53-61.

Sept. 2, 2012

Academic Institutions and Nonprofits only

#35110

John McCusker

Ito-Harashima et al Yeast. 2004 Jan 15;21(1):53-61.

Sept. 2, 2012

Academic Institutions and Nonprofits only

#35112

John McCusker

Ito-Harashima et al Yeast. 2004 Jan 15;21(1):53-61.

Sept. 13, 2012

Academic Institutions and Nonprofits only

#160930

Expression of soluble Sc octamer (H3)

Stephen Harrison

Dec. 7, 2020

Academic Institutions and Nonprofits only

#160929

Expression of soluble Sc octamer (Cse4)

Stephen Harrison

Dec. 7, 2020

Academic Institutions and Nonprofits only

#35102

John McCusker

Hartzog et al Yeast. 2005 Jul 30;22(10):789-98.

April 19, 2012

Academic Institutions and Nonprofits only

#35104

John McCusker

Hartzog et al Yeast. 2005 Jul 30;22(10):789-98.

Aug. 29, 2012

Academic Institutions and Nonprofits only

#35105

John McCusker

Hartzog et al Yeast. 2005 Jul 30;22(10):789-98.

Aug. 29, 2012

Academic Institutions and Nonprofits only

#35114

John McCusker

Ito-Harashima et al Yeast. 2004 Jan 15;21(1):53-61.

Aug. 29, 2012

Academic Institutions and Nonprofits only

#37548

Wei-Lih Lee

Vorvis et al Yeast. 2008 Sep;25(9):651-9.

July 12, 2012

Academic Institutions and Nonprofits only

#111911

Expresses gRNA to target Nte1 locus and has HygR marker

Yi Tang

Aug. 13, 2018

Academic Institutions and Nonprofits only