We narrowed to 2,405 results for: dcas9
-
Plasmid#149638Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, emptyDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30Available sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pBbdCas9S_Psyn-sgRNA500
Plasmid#149640Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
SunTagng14aa
Plasmid#106439PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genome.DepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN414aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
PV225
Plasmid#132334PurposedCas9 plant transcriptional activator (AT-CBF1) linked constitutive expression cassette for Zea maysDepositorInsertdCas9-AT-CBF1 (CBF1 Cas9 (Streptococcus pyogenes); AT-CBF1 (Arabidopsis thaliana))
TagsAT-CBF1ExpressionPlantMutationCodon optimize for expression and stability in Ze…Available sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSB700-mouse-ACTC1-Puro
Plasmid#128326PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (mouse cells)DepositorInsertgRNA against mouse ACTC1 for activation (Actc1 Mouse)
ExpressionMammalianAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB700-ACTC1-Puro
Plasmid#128324PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (human cells)DepositorInsertgRNA against human ACTC1
ExpressionMammalianAvailable sinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2XNLS-SpCas9WT-NLS-3XHA-2XNLS-NmdCas9-NLS
Plasmid#107327PurposeExpresses SpCas9 fused to dNmCas9 in mammalian cellsDepositorInsertSpCas9-NmCas9 fusion
UseCRISPRTagsNLSExpressionMammalianMutationSpCas9 is fused to nuclease dead NmCas9 (D16A, D5…PromoterCMV IE94Available sinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9 (GB1079)
Plasmid#75399PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid part for C-terminal fusionsDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
LLP340 pEF1a-NLS-scFvGCN4-DNMT3a (mutant)
Plasmid#100944PurposeSingle chain variable fragment antibody GCN4 fused to DNMT3a catalytic mutant, binds SunTag, with 3xTy1 tagDepositorInsertscFvGCN4, sfGFP, GB1, DNMT3a catalytic mutant (DNMT3A Synthetic, Human)
Tags3xTy1ExpressionMammalianMutationF636A, E660A, E725A, R295AAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
NLS-HA-2xMCP-KRAB
Plasmid#126589PurposeExpresses MCP (MS2 Coat Protein) fusion to KRAB in mammalian cells, lentiviral backboneDepositorInsert2XMCP-KRAB
UseLentiviralTagsNLS-HAExpressionMammalianPromoterhuman ubiquitin C promoterAvailable sinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMYCO1_SpdCas9_pmcDA1
Plasmid#204615PurposeCRISPR cytosine deaminase replicative plasmid for Mycoplasma mycoides subsp. mycoidesDepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable sinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLG1 library vector (pU6-sgRNA Ef1alpha-Puro-T2A-BFP)
Plasmid#217305PurposesgRNA BFP + PuromycinDepositorInsertpU6-sgRNA, Ef1alpha-Puro-T2A-BFP
UseCRISPR and Synthetic BiologyPromoterU6, Ef1alphaAvailable sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LLP453 pEf1a-NLS-aGCN4-mCherry
Plasmid#100945PurposemCherry fusion to single change variable fragment antibody GCN4 for use in SunTag system , with 3xTy1 tagDepositorInsertscFvGCN4, sfGFP, GB1, mCherry
Tags3xTy1ExpressionMammalianAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pW210-pPB-GA-inducible-CRISPRa-sa_dCas9-VPR-hygR
Plasmid#170808PurposePiggyBac vector to express GA-inducible VPR-Sa_dCas9 with hygromycin resistanceDepositorInsertsExpressionMammalianMutationSynonymous mutation in PYL1 to remove XhoI site (…Available sinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-catΔ
Plasmid#222501PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant catΔ (C706A and R832E) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant catΔ (C706A and R832E) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; C706A and R832…PromoterEFSAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-R1R2_EF1adCas9VP64_T2A_MS2p65HSF1-IRESbsdpA
Plasmid#112924PurposepiggyBac transposon vector carrying human EF1a promoter-driven dCas9VP64-T2A-MS2p65HSF1 with Blasticidin resistant markerDepositorInsertEF1a promoter, dCas9VP94, MS2p65HSF1, IRESneo
UsePiggybac transposon vectorExpressionMammalianAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV_Zdk3-VPR_P2A_dCas9-AsLOVx3-NLSx3
Plasmid#231568PurposeExpresses components of the LOOMINA optogenetic transcriptional control system.DepositorInsertAll-in-one LOOMINA construct
UseCRISPRExpressionMammalianAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_dCas9-XTEN-KRAB-p2A-GFP
Plasmid#222108PurposeDonor vector for CRISPRi integration at AAVS1 with a GFP fluorophoreDepositorInsertCRISPRi-kox1(KRAB) (cas9 Human, S. pyogenes)
UseAAV and CRISPRTagsHA and P2A-GFPExpressionMammalianMutationD10A, H840AAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196079PurposeConstitutive CRISPRi vector conferring puromycin resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only