We narrowed to 9,186 results for: sacs
-
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorInsertSRP14 gRNA (SRP14 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorInsertTLG1 gRNA (TLG1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorInsertVHT1 gRNA (VHT1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorInsertLEU2 gRNA (LEU2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorInsertINO80 gRNA (INO80 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA3-Sec7-mEYFP
Plasmid#218968PurposeGene replacement plasmid to label S. cerevisiae Sec7 with mEYFPDepositorInsertSEC7-mEYFP (SEC7 Budding Yeast)
UseGene replacementTagsmEYFPExpressionMutationPromoterAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA-Sec7-mGold
Plasmid#218967PurposeGene replacement plasmid to label S. cerevisiae Sec7 with mGoldDepositorInsertSEC7-mGold (SEC7 Budding Yeast)
UseGene replacement vector for yeastTagsmGoldExpressionMutationPromoterAvailable sinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-Kar2-moxGFP2-HDEL
Plasmid#218970PurposeGene replacement plasmid to label S. cerevisiae Kar2 with moxGFP2DepositorInsertKAR2-moxGFP2-HDEL (KAR2 Budding Yeast)
UseGene replacement vector for yeastTagsmoxGFP2ExpressionMutationPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA3-Sec7-msYFP2
Plasmid#218969PurposeGene replacement plasmid to label S. cerevisiae Sec7 with msYFP2DepositorInsertSEC7-msYFP2 (SEC7 Budding Yeast)
UseTagsmsYFP2ExpressionYeastMutationPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG416-GAL-RNQ1
Plasmid#181706PurposeGalactose inducible expression of RNQ1DepositorInsertRNQ1 (RNQ1 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
KBB96
Plasmid#185113PurposeBacterial expression of C-terminus of NUP1 nucleoporin as GST-Nup1-C fusion truncated so only one FXFG repeat remainsDepositorInsertNUP1
UseTagsGSTExpressionBacterialMutationLast FXFG domain of Nup1PromoterAvailable sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB109
Plasmid#185066PurposeBacterial expression of C-terminus of NUP1 nucleoporin as GST-Nup1-C fusion truncated after NsiI restriction siteDepositorInsertNUP1
UseTagsGSTExpressionBacterialMutationNup1 C-terminal region, truncated at NsiI restric…PromoterAvailable sinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_MET16
Plasmid#166091PurposePlasmid for constituive spCas9 and tet-inducible MET16 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertMET16 (MET16 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceMay 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP1
Plasmid#166103PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination.DepositorInsertMsn2-sgRNA#27 (MSN2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP2
Plasmid#166104PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorInsertMsn2-sgRNA#27 (MSN2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CPR1_1
Plasmid#166074PurposePlasmid for constituive spCas9 and tet-inducible CPR1 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertCPR1 (CPR1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RRT8
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorInsertPromoter of RRT8 (RRT8 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CPR1_2
Plasmid#166071PurposePlasmid for constituive spCas9 expression and tet-inducible expression of an sgRNA targeting an intergenic site near CPR1 for double stranded break formation in yeast.DepositorInsertIntergenic region near CPR1
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_GAL7
Plasmid#166089PurposePlasmid for constituive spCas9 and tet-inducible GAL7 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertGAL7 (GAL7 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CUP1-1
Plasmid#166086PurposePlasmid for constituive spCas9 and tet-inducible CUP1-1 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertCUP1-1 (CUP1-1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP3
Plasmid#166105PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorInsertMsn2-sgRNA#27 (MSN2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_GLK1
Plasmid#166090PurposePlasmid for constituive spCas9 and tet-inducible GLK1 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertGLK1 (GLK1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_LHS1
Plasmid#166092PurposePlasmid for constituive spCas9 and tet-inducible LHS1 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertLHS1 (LHS1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_APL3
Plasmid#166073PurposePlasmid for constituive spCas9 and tet-inducible APL1-targeting sgRNA expression for double stranded break formation in yeastDepositorInsertAPL3 (APL3 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_YBL055C
Plasmid#166077PurposePlasmid for constituive spCas9 and tet-inducible YBL055C targeting sgRNA expression for double stranded break formation in yeastDepositorInsertYBL055C (near PTC3) (YBL055C Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_YNR071C
Plasmid#166081PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of YNR071C for double stranded break formation in yeast.DepositorInsertPromoter of YNR071C (YNR071C Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_SLA1
Plasmid#166075PurposePlasmid for constituive spCas9 and tet-inducible SLA1 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertSLA1 (SLA1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_PPE1
Plasmid#166083PurposePlasmid for constitutive spCas9 and tet-inducible PPE1 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertPPE1 (PPE1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_PDR12
Plasmid#166093PurposePlasmid for constituive spCas9 and tet-inducible PDR12 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertPDR12 (PDR12 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_TDH2
Plasmid#166082PurposePlasmid for constituive spCas9 and tet-inducible TDH2 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertTDH2 (TDH2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only