We narrowed to 3,217 results for: Streptococcus
-
Plasmid#187954PurposeFKBP12 (F36V mutant) degron-tagged dCas9-hHDAC4 fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-hHDAC4-tagBFP
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
EC2_3_dCas9_Mxi1_sgRNA
Plasmid#163708PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and Mxi1 transcriptional repressorDepositorInsertsdCas9
Mxi1+SV40 NLS
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgENPP1_#3-hygro
Plasmid#254680Purposeknockout human ENPP1DepositorInsertsgRNA with Cas9 and hygromycin resistance (ENPP1 Human)
UseCRISPR and LentiviralAvailable sinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgENPP1_#2-hygro
Plasmid#254679Purposeknockout human ENPP1DepositorInsertsgRNA with Cas9 and hygromycin resistance (ENPP1 Human)
UseCRISPR and LentiviralAvailable sinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgENPP1_#1-hygro
Plasmid#254678Purposeknockout human ENPP1DepositorInsertsgRNA with Cas9 and hygromycin resistance (ENPP1 Human)
UseCRISPR and LentiviralAvailable sinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJK422
Plasmid#155373PurposedCas9 oscillator v1 (dCRv1) + [dCas9 + PA4-mVenus]. (Integration of 412; pOSIP)DepositorInsertsdCas9 (bacteria)
PA4-mVenus
dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)Available sinceDec. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJK423
Plasmid#155374PurposedCas9 oscillator v1 (dCRv1) + [dCas9 + PA4-mVenus]. (Integration of 413; pOSIP)DepositorInsertsdCas9 (bacteria)
PA4-mVenus
dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)Available sinceDec. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJK412
Plasmid#155371PurposedCas9 oscillator v1 (dCRv1) + [dCas9 + PA4-mVenus]DepositorInsertsdCas9 (bacteria)
PA4-mVenus
dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)AvailabilityAcademic Institutions and Nonprofits only -
cBEST2
Plasmid#234658PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterkasO*17tss and kasOp*Available sinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFGC-I2Cas9
Plasmid#173158PurposeExpresses Cas9 in dividing Arabidopsis cells. Contains dsRED and Basta for fast transformant selection.DepositorInsertshSpCas9
pNAP:dsRED:tNOS
pMAS:BAR:tMAS
ICU2 upstream regulatory region
Tags3xFLAG-NLS and NLSExpressionPlantMutationContains a D169N mutation with no visible effect …Available sinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
cBEST3
Plasmid#234659PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3 and kasO17tssAvailable sinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYN2_1
Plasmid#184757PurposePlasmid for genome editing by CRISPR/Cas9DepositorInsertsCas9
sgRNA scaffold where sfGFP is replaced with gRNA protospacer of interest, which will be proceeded by the HDV Ribozyme
UseSynthetic BiologyTags2xNLSExpressionBacterial and YeastPromoterPGK1 and tRNA-Phe-HDV RibozymeAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJK429
Plasmid#155376PurposePphlF_A4NT in dCRv1, 1x cascade + [dCas9 + PA4-mVenus]DepositorInsertsdCas9 (bacteria)
PA4-mVenus
PphlF_A4NT in dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)Available sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-AID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187960PurposeAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-HITI-2c ACTB
Plasmid#206267PurposeAll in one recombinant baculovirus production vector. Encodes Cas9, sgRNA and donor for homology independent targeted integration in the ACTB locus.DepositorInsertSpCas9 (S. Pyogenes), hACTB HITI-2c donor, mCherry, Puro-R, hU6 hACTB sgRNA, AcrIIA4, eGFP
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-SMASh-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187949PurposeSMASh degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSMASh-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6_B2M_sgRNA(PP7)
Plasmid#232438PurposesgRNA to facilitate a splice donor site disruption via adenine base editing in the B2M locus, contains a PP7 aptamer in the scaffold tetraloopDepositorInsertPP7-tagged gRNA for B2M disruption via splice donor consensus disruption via ABE8e or Cas9 driven by human U6 promoter
UseCRISPRPromoterU6Available sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-Tet1c-dCas9
Plasmid#232178PurposeLentiviral cassette that expresses Tet1c-dCas9 fusion with a short linker in mammalian cellsDepositorInsertTet1 catalytic domain - dead Cas9 - 2A - BlastR (TET1 Human, S. pyogenes)
UseLentiviralTagsFLAGExpressionMammalianMutationD10A, H840APromoterhUbCAvailable sinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only