We narrowed to 9,182 results for: Pol;
-
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUltra-MDH1-ME1
Plasmid#184465PurposeLentiviral vector for tri-cistronic expression of EGFP, MDH1 and ME1 (seperated by P2A and T2A)DepositorUseLentiviralTagsfused to T2AExpressionMammalianMutationdeletion of stop codonPromoterUbCAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLPC-puromycin-binary-MDH1-3xFLAG-ME1- HA
Plasmid#184549PurposeRetroviral vector to co-express human MDH1 with 3xFLAG tag and human ME1 with HA tagDepositorUseRetroviralTags3xFLAG and HA tagExpressionMammalianPromoterCMVAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ spike_del19
Plasmid#155297PurposeExpression of spike with C-term deletion of 19 aa, used to generate high efficiency SARS-CoV-2-pseudotyped lentiviral particlesDepositorInsertSARS-Cov2 spike_deleted (S SARS-Cov2)
UseGeneration of sars-cov-2-pseudotyped lentiviral p…MutationDeletion in C-term 19 aa of spikePromoterCMVAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHIPH4
Plasmid#117685PurposeHansenula polymorpha expression plasmidDepositorInsertAlcohol Oxidase promoter
ExpressionYeastPromoterAlcohol OxidaseAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pETM41-EcPPK
Plasmid#38334DepositorInsertE. coli polyphosphate kinase (ppk Escherichia coli)
Tags6xHIS, MBP, and TEVExpressionBacterialPromoterT7Available SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKM263-EcPPK
Plasmid#38333DepositorInsertE. coli polyphosphate kinase (ppk Escherichia coli)
Tags6xHIS, GST, and TEVExpressionBacterialPromoterT7Available SinceAug. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDKIER
Plasmid#37093DepositorExpressionMammalianPromoterCMVAvailable SinceJuly 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA2-MpCKB
Plasmid#238528PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKB
Plasmid#238527PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKA
Plasmid#238526PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 alphaDepositorInsertMpCKA
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.MCV.cLT206.V5(CM2B4)
Plasmid#28189DepositorInsertMCPyV Large T antigen (206 wild-type strain)
TagsV5ExpressionBacterial and MammalianAvailable SinceSept. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB-327-Ef1-MpCKA-WT-TagRFP
Plasmid#238529PurposePlant expression of wild-type M. polymorpha CK2 alpha, tagged with TagRFP in plantsDepositorInsertMpCKA
TagsTagRFPExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.MCV.LT206.V5(CM2B4)
Plasmid#28190DepositorInsertMCPyV genomic T antigen locus (206 wild-type strain)
TagsV5ExpressionBacterial and MammalianAvailable SinceMay 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB-327-Ef1-MpCKA-K151M-D258N-TagRFP
Plasmid#238530PurposePlant expression of M. polymorpha CK2 alpha K151M, D258N, tagged with TagRFP in plantsDepositorInsertMpCKA
TagsTagRFPExpressionPlantMutationK151M, D258NAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
mP_ILB_Vector 1
Plasmid#232193PurposeThe plasmid vector designed for the expression of four genes in oleaginous yeasts, including Yarrowia lipolytica and Rhodotorula toruloides.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceMarch 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA-ncpGCaMP6s
Plasmid#113674PurposeA topological variant of GCaMP6sDepositorInsertncpGCaMP6s
ExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pST44
Plasmid#64007Purposepolycistronic cloning vector for pST44 plasmid suiteDepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST39
Plasmid#64009Purposeoriginal polycistronic cloning vector for plasmid suite (generation I)DepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGustiv
Plasmid#240335PurposeExpresses BK polyomavirus genotype IV capsid protein VP1 in yeast. Expression of VP1 (and a GFP reporter) is induced by maltose.DepositorInsertsBKV-IV VP1
Superfold GFP
Formaldehyde dehydrogenase 1
ExpressionYeastPromoterFDH1, MAL31, and MAL32Available SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits