We narrowed to 15,272 results for: grn
-
Plasmid#226988PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A9)DepositorInsertSpCas9 gRNA A9 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(12))-PGKpuroBFP-W
Plasmid#208569PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(13))-PGKpuroBFP-W
Plasmid#208570PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(21))-PGKpuroBFP-W
Plasmid#200507PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200506PurposeLentiviral vector expressing gRNA targeting human ARID1A and AAVS1DepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(23))-PGKpuroBFP-W
Plasmid#200508PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(AAVS1)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#200502PurposeLentiviral vector expressing gRNA targeting human AAVS1DepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200503PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and AAVS1DepositorAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(47))-PGKpuroBFP-W
Plasmid#200505PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBHM2329
Plasmid#171686PurposepRS316-PCnU6-scaffold, contains template for amplification of PCnU6 and scaffold for fusion PCRDepositorInsertPCnU6-sgRNA_scaffold
UseCRISPRExpressionBacterial and YeastPromoterC. neoformans U6Available sinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSicoR-mCh-Oct4i
Plasmid#21906DepositorInsertOct4i
UseLentiviral and RNAiExpressionMammalianAvailable sinceSept. 30, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pST_140_LVL2 cam
Plasmid#179334PurposeNT-CRISPR plasmid for a single gRNA with spG Cas9 (near PAM-less Cas9 variant).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPtac tfoX, Ptet spG cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRMutationCas9 -> SpG Cas9 (D1135L, S1136W, G1218K, E121…Available sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPtGE34
Plasmid#107932PurposeExpresses Cas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
UseCRISPR and Synthetic Biology; Episomal vector for…Available sinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-3'UTR
Plasmid#136036PurposeUPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRGEB32-BAR
Plasmid#126072PurposeFor CRISPR/Cas9 delivery in maize. Expresses Cas9 with rice ubiquitin promoter, BAR with 35S promoter, and sgRNA/PTG with rice snoRNA U3 promoter (pol III). Can produce 1 or more gRNAs.DepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoter35S for BAR; Rice UBI for Cas9; Rice snoRNA U3 fo…Available sinceJune 24, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEG302-SunTagng-22aa
Plasmid#115345PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genomeDepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
act-AsCpf1
Plasmid#73917Purposeexpression plasmid of AsCpf1DepositorInserthAsCpf1
TagsNLS-3xHAExpressionInsectPromoteract5CAvailable sinceMarch 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgTP53_3
Plasmid#78164PurposesgTP53DepositorAvailable sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOsU3
Plasmid#170132PurposeFor sgRNA expression in monocotyledons protoplastsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pC0043-PspCas13b-gRNA non target
Plasmid#223698PurposegRNA control for dPspCas13b-FTODepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA target sequence for luciferase control
UseCRISPRExpressionMammalianAvailable sinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by