We narrowed to 16,429 results for: grna
-
Plasmid#77716Purpose3rd generation lentiviral gRNA plasmid targeting human MARK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
STK4 gRNA (BRDN0001149002)
Plasmid#76074Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - DDX3Y sgRNA 2
Plasmid#70657PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97312PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. Lenti backbone.DepositorInsertActb HMEJ donor
UseLentiviral and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
CSK gRNA (BRDN0001149085)
Plasmid#77767Purpose3rd generation lentiviral gRNA plasmid targeting human CSKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK1A1 gRNA (BRDN0001145896)
Plasmid#76190Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1A1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIKFYVE gRNA (BRDN0001148312)
Plasmid#76893Purpose3rd generation lentiviral gRNA plasmid targeting human PIKFYVEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-MS2
Plasmid#184839PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
CDK7 gRNA (BRDN0001147450)
Plasmid#76080Purpose3rd generation lentiviral gRNA plasmid targeting human CDK7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BRD4 gRNA (BRDN0001146786)
Plasmid#77346Purpose3rd generation lentiviral gRNA plasmid targeting human BRD4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRPR1(1xTetO)_gRNA_handle_RPR1t
Plasmid#62966PurposeaTc inducible gRNA expression vectorDepositorTypeEmpty backboneExpressionYeastPromoterRPR1Available SinceMarch 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330 RBP1 gRNA
Plasmid#165593PurposeInsertion of RBP1 degronDepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6 SgRNA GAPDH
Plasmid#162736PurposeMammalian expressionDepositorInsertSpacer sequence for GAPDH
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
gRNA-hIRF-1 #12/pSIR
Plasmid#61080PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoterDepositorInsertgRNA_hIRF1 promoter #12 (IRF1 Human)
UseCRISPR and RetroviralExpressionMammalianPromoterU6Available SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-pegRNA_KCNA1-EGFP
Plasmid#159787PurposeS. pyogenes pegRNA for C to A mutation at the KCNA1 site of human cells using prime editingDepositorInsertspacer of pegRNA targeting KCNA1 gene (KCNA1 Human)
ExpressionMammalianAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-gfap-sgRNA
Plasmid#65566Purposein vitro trancription of sgRNA targeting the zebrafish gfap locusDepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1C gRNA (BRDN0001145164)
Plasmid#77667Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CD2 gRNA (BRDN0001148522)
Plasmid#75828Purpose3rd generation lentiviral gRNA plasmid targeting human CD2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DDR1 gRNA (BRDN0001162484)
Plasmid#78011Purpose3rd generation lentiviral gRNA plasmid targeting human DDR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only