We narrowed to 11,445 results for: nar
-
Plasmid#136891PurposeLentivirus for base editing activatable GFP expression in mammalian cellsDepositorInsertGFPGO2(NGG)
UseLentiviralTags2xNLSMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT003
Plasmid#182713PurposeaTc inducible dCasRx-IF3DepositorInsertdCasRx
UseCRISPRTags3x(GGGS)-Escherichia Coli Initiation Factor 3ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpTetAvailable SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET42a-lambdaN+-L+-GSH
Plasmid#98894PurposeExpresses lambdaN+-L+-GST fusion protein for affinity purification with ARiBo methodDepositorInsertlambdaN+-L+
TagsGST tagExpressionBacterialPromoterT7 promoterAvailable SinceAug. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRG645_lexO-AscI_LexA-TF_LEU2MX
Plasmid#154813PurposeInducible expression of AscI endonuclease in S. cerevisiaeDepositorInsertsAscI endonuclease
LexA-ER-B112
TagsFLAG and NLSExpressionYeastPromoterACT1 and lexO_4-CYC1_coreAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRG714_lexO-AscI_LexA-TF_URA3MX
Plasmid#154822PurposeInducible expression of AscI endonuclease in S. cerevisiaeDepositorInsertsAscI endonuclease
LexA-ER-B112
TagsFLAG and NLSExpressionYeastPromoterACT1 and lexO_4-CYC1_coreAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A-CmYLCV-dCas9-24XGP41
Plasmid#202009PurposeMoclo level 1 - Module A, Promoter: CmYLCV, Gene: dCas9-24XGP41, Terminator: HSPDepositorInsertdCas9-24XGP41
UseSynthetic Biology; Moclo level 1 vectorTagsGS linkersPromoterCmYLCVAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJK506
Plasmid#155382PurposedCas12a (D917A) + PA4-mVenus. (removed crRNAs)DepositorInsertsdCas12a (F. novicida)
PA4-mVenus
UseCRISPRExpressionBacterialMutationD917A (nuclease-deactivating)Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
p-attB-min.hsp70P-FRT-STOP#1-FRT-DamMycLAM
Plasmid#71811PurposeGenerating transgenic flies for FLP-inducible DamIDDepositorInsertmin.hsp70P-FRT-STOP#1-FRT-Dam-Myc-LAM
ExpressionInsectAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHD1
Plasmid#30974DepositorInsertrepeat HD1
Available SinceJune 30, 2011AvailabilityAcademic Institutions and Nonprofits only -
pFUS_B10
Plasmid#31027DepositorInsertLacZ + BsaI restriction sites
Available SinceJune 30, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–CgRNA
Plasmid#64955PurposeControl gRNA (GTCAAGGCACTCTTGCCTA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS_KS_attB2_SA(0)_T2AGAL4
Plasmid#125211PurposeArtificial phase 0 exon to include a spliced T2A-GAL4 effector into a locus of interest through RMCE of MiMIC insertion in an intron between coding exons of a geneDepositorInsertGAL4
UseOtherTagsT2AAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
PBDGTV
Plasmid#100859PurposeA piggyBac transposon based dual directional gene trap vector, in which, the mutagens are two non-selectable gene-trap cassettes in opposite orientations.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceNov. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTG131
Plasmid#198640PurposeThermosensitive pSC101-based plasmid expressing a sgRNA under the control of the J23119 promoter and Cas9 under the control of the DAPG-inducible PhlF promoterDepositorInsertCas9
ExpressionBacterialPromoterpPhlFAvailable SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRG710_lexO-HO_LexA-TF_HIS3MX
Plasmid#154819PurposeInducible expression of HO endonuclease in S. cerevisiaeDepositorInsertsTagsFLAGExpressionYeastPromoterACT1 and lexO_4-CYC1_coreAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBS_KS_attB2_SA(1)_T2AGAL4
Plasmid#125212PurposeArtificial phase 1 exon to include a spliced T2A-GAL4 effector into a locus of interest through RMCE of MiMIC insertion in an intron between coding exons of a geneDepositorInsertGAL4
UseOtherTagsT2AAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
GST TopBP1 C (aa 978-1522)
Plasmid#20373DepositorAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pBS_KS_attB2_SA(2)_T2AGAL4
Plasmid#125213PurposeArtificial phase 2 exon to include a spliced T2A-GAL4 effector into a locus of interest through RMCE of MiMIC insertion in an intron between coding exons of a geneDepositorInsertGAL4
UseOtherTagsT2AAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
GST TopBP1 B (aa 978-1192)
Plasmid#20372DepositorAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only