We narrowed to 4,673 results for: pcr
-
Plasmid#212761PurposeN-terminal PCR-based tagging with pCUP1-His7-NUbo in budding yeast with URA3 selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pUra3-pCUP1-NUbo
Plasmid#212760PurposeN-terminal PCR-based tagging with pCUP1-NUbo in budding yeast with URA3 selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGuide-P1-O1a (EL702)
Plasmid#140040PurposeCRISPR DuMPLING negative control plasmid with probe/barcode P1 and negative control lacO1array spacer in the sgRNA. Also template for library PCRs.DepositorInsertbarcode P1 and sgRNA lacO1 array
UseSynthetic BiologyAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTGC-U6.3
Plasmid#112810PurposePCR template vector for amplifying gRNAcore-pU6.2 promoter fragmentDepositorInsertU6:3-gRNAcore
ExpressionBacterialAvailable sinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJW1927
Plasmid#163093PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsertmScarlet-I^SEC (Lox511I)^TEV::AID*::3xFLAG
UseCRISPR and Cre/LoxExpressionWormAvailable sinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pc2099-pEGFP-H3.1
Plasmid#241429PurposeExpresses human Histone H3.1 as fusion to GFP constructed by PCR using Primers: h3.1-cl-fw (AAGAATTCAATGGCTCGTACGAAGCAAAC) and h3.1-cl-rv (AAGCGGCCGCTGCCCTTTCCCCACGGATG) cloned into pEGFP-C1DepositorAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJL258
Plasmid#243697PurposeA piggyBac vector containing the endogenous NDUFB9 genomic locus, with its native 5' UTR replaced by the Actb 5' UTR, modified with silent mutations to allow for PCR-based analysisDepositorInsertNDUFB9 genomic locus, with its 5' UTR replaced by the ACTB 5' UTR (NDUFB9 Human)
ExpressionMammalianAvailable sinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL259
Plasmid#243698PurposeA piggyBac vector containing the endogenous NDUFB9 genomic locus, with its native 3' UTR replaced by the Actb 3' UTR, modified with silent mutations to allow for PCR-based analysisDepositorInsertNDUFB9 genomic locus, with its 3' UTR replaced by the ACTB 3' UTR (NDUFB9 Human)
ExpressionMammalianAvailable sinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL354
Plasmid#243709PurposeA piggyBac vector containing the endogenous COX7A2 genomic locus, with its native 5' UTR replaced by the Actb 5' UTR, modified with silent mutations to allow for PCR-based analysisDepositorInsertCOX7A2 genomic locus, with its 5' UTR replaced by the ACTB 5' UTR (COX7A2 Human)
ExpressionMammalianAvailable sinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTE5423_p3WJdB-glcO60
Plasmid#221194PurposeDNA template of GlcR sensor with glcO60 operator: T7 promoter-glcO60-3WJdB reporter-T7 terminator linear DNA template (PCR amplified with oSB0021+22) is used in the IVT sensor systemDepositorInsertT7 promoter-glcO60-3WJdB
UseSynthetic BiologyExpressionBacterialPromoterT7 promoter with downstream glcO60 operatorAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHyg-CUbo(K48R/K63R)-yeGFP-His6
Plasmid#212785PurposeC-terminal PCR-based tagging with CUbo(K48R/K63R)-yeGFP-His6 in budding yeast with HygR selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAct-GST-H3
Plasmid#182842PurposeA PCR product encoding GST-H3 (Drosophila histone H3) was was inserted into a modified pAct-5c vector by Sac I and Sal I sites. Expression in S2 cells.DepositorInsertGST-histone H3 fusion
TagsGSTExpressionInsectPromoterActin5CAvailable sinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
PASTA-5_pUC19_IVT-ePa01
Plasmid#247041PurposePlasmid for in vitro transcription (IVT) of enhanced Pa01 (ePa01) mRNA. Use indicated PCR-primers for correction of T7-mutation and addition of poly-A-tail.DepositorPublicationInsertePa01 recombinase (large serine integrase, LSR) for IVT
ExpressionBacterial and MammalianAvailable sinceSept. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
PASTA-1_pUC19_HDR-Bxb1-attG_TRAC_for-Cas12a
Plasmid#247037PurposeEncodes HDR-template for Cas12a-mediated Knock-In of Bxb1-attG (landing pad) into TRAC gene (exon1). Template region to be PCR-amplified.DepositorPublicationInsertBxb1 bacterial attachment site (attB) = genomic attachment site (attG), flanked by human TRAC homology arms
ExpressionBacterialAvailable sinceSept. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pNDGG039
Plasmid#231339PurposeTerminator; BEVA2.0 T15m terminator with DF extension for CIDAR MoClo Golden Gate Assembly, DF module. Cloned via BpiI GG Assembly of PCR amplicon into POGG006, SpR.DepositorInsertBEVA2.0 T15m terminator with DF extension for CIDAR MoClo Golden Gate Assembly, DF module.
ExpressionBacterialAvailable sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG038
Plasmid#231338PurposeTerminator; BEVA2.0 T12m terminator with DF extension for CIDAR MoClo Golden Gate Assembly, DF module. Cloned via BpiI GG Assembly of PCR amplicon into POGG006, SpR.DepositorInsertBEVA2.0 T12m terminator with DF extension for CIDAR MoClo Golden Gate Assembly, DF module.
ExpressionBacterialAvailable sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG037
Plasmid#231337PurposeTerminator; BEVA2.0 T2m terminator with DF extension for CIDAR MoClo Golden Gate Assembly, DF module. Cloned via BpiI GG Assembly of PCR amplicon into POGG006, SpR.DepositorInsertBEVA2.0 T2m terminator with DF extension for CIDAR MoClo Golden Gate Assembly, DF module.
ExpressionBacterialAvailable sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-G2304D
Plasmid#182845Purposemutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sitesDepositorAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
PASTA-3_pUC19_HDR-Pa01-attG_TRAC_for-Cas12a
Plasmid#247039PurposeEncodes HDR-template for Cas12a-mediated Knock-In of size-reduced Pa01-attG (landing pad) into TRAC gene (exon1). Template region to be PCR-amplified.DepositorPublicationInsertPa01 bacterial attachment site (attB) = genomic attachment site (attG), flanked by human TRAC homology arms
Available sinceSept. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMVQA
Plasmid#197894PurposepCR®2.1-TOPO® backbone with 3' end of HIV-1(HXB2:9045 till poly-A (20))DepositorInsertHIV-1 3' end (HXB2: 9045 till poly-A(10)
ExpressionBacterialAvailable sinceJune 7, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by