We narrowed to 9,455 results for: BLI

#206118

expression of Cav2.1 N-terminus (amino acids 1-100) with C-terminal CAAX (last 10 aa of H.Ras) motif

Annette Dolphin

Page et al J Biol Chem. 2010 Jan 8;285(2):835-44. d

Oct. 31, 2023

Academic Institutions and Nonprofits only

#206068

expression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1

Annette Dolphin

Page et al J Neurosci. 2004 Jun 9;24(23):5400-9. do

Oct. 12, 2023

Academic Institutions and Nonprofits only

#194187

Includes the promoter (1kb) of SMTS (SMANTIS, MANTIS, AK125871)

Ralf Brandes, Matthias Leisegang

Leisegang et al Eur Heart J. 2019 Aug 7;40(30):2523-2533

Jan. 24, 2023

Academic Institutions and Nonprofits only

#166680

Yeast integrative plasmid for expressing deltaVP1 (GAL1 promoter) and mouse myo-inositol oxygenase tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).

Claudia Vickers

Cheah et al ACS Synth Biol. 2021 Dec 17;10(12):3251-

April 9, 2021

Academic Institutions and Nonprofits only

#166674

Yeast integrative plasmid for expressing wild-type Murine polyomavirus VP1 (GAL1 promoter) and GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).

Claudia Vickers

Cheah et al ACS Synth Biol. 2021 Dec 17;10(12):3251-

April 8, 2021

Academic Institutions and Nonprofits only

#162694

p1A negative control expressing CbbLS and inactive Prk (Prk K20M S21A)

David Savage

Flamholz et al Elife. 2020 Oct 21;9. pii: 59882. doi: 1

Feb. 9, 2021

Academic Institutions and Nonprofits only

#157857

donor plasmid for FMR1-Nluc

Xinyu Zhao

Li et al Stem Cells. 2017 Jan;35(1):158-169. doi:

Jan. 20, 2021

Academic Institutions and Nonprofits only

#132395

Targets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backbone

Gerold Schmitt-Ulms

Wang et al Bio Protoc. 2020 May 5;10(9):e3615. doi:

May 6, 2020

Academic Institutions and Nonprofits only

#99362

Bacterial expression vector containing cDNA encoding for the temperature sensitive fission yeast tropomyosin mutant, Cdc8.27.

Dan Mulvihill

Johnson et al Biochem Biophys Res Commun. 2017 Oct 25.

Oct. 31, 2017

Academic Institutions and Nonprofits only

#52515

expresses C. elegans LIN-29 in mammalian cells with RGS-6xHis tag at N-terminus

Adam Antebi

Horn et al Dev Cell. 2014 Mar 4. pii: S1534-5807(14

Aug. 4, 2015

Academic Institutions and Nonprofits only