We narrowed to 5,812 results for: 129
-
Plasmid#211240PurposeMammalian expression of full-length human EML1. N-terminal HiBiT tag.DepositorInsertEML1:M1-I815 (EML1 Human)
TagsMVSGWRLFKKISGSSGGSSGExpressionMammalianMutationH552N natural variant (VAR_031721)PromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBiT3.1-C_EML1:1-815
Plasmid#211314PurposeMammalian expression of full-length human EML1. C-terminal HiBiT tag.DepositorInsertEML1:M1-I815 (EML1 Human)
TagsGSSGGSSGVSGWRLFKKISExpressionMammalianMutationH552N natural variant (VAR_031721)PromoterCMVAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
JGI_018103
Plasmid#158921PurposeHydrocarbon Structures for Fuels and ChemicalsDepositorInsertWP_012948569_1
UseSynthetic BiologyAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORFE0011
Plasmid#112075PurposepcUBI promoter module Pro+5UDepositorInsertpcUBI promoter
ExpressionPlantMutationBsaI and BpiI restriction sites have been remove…Available SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-Palladin-C-7
Plasmid#54213PurposeLocalization: Cytoskeleton, Excitation: 487, Emission: 509DepositorInsertPalladin
TagsmEmeraldExpressionMammalianPromoterCMVAvailable SinceJuly 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUltra-Plus
Plasmid#161775Purpose3rd generation lentiviral multicistronic vector for mammalian expression of three genes of interestDepositorTypeEmpty backboneUseLentiviral; MulticistronicExpressionMammalianPromoterUbCAvailable SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Palladin-C-7
Plasmid#55113PurposeLocalization: Cytoskeleton, Excitation: 587, Emission: 610DepositorInsertPalladin
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
mVenus-Palladin-C-7
Plasmid#56391PurposeLocalization: Cytoskeleton, Excitation: 515, Emission: 528DepositorInsertPalladin
TagsmVenusExpressionMammalianPromoterCMVAvailable SinceDec. 18, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
tdTomato-Palladin-C-7
Plasmid#58122PurposeLocalization: Cytoskeleton, Excitation: 554, Emission: 581DepositorInsertPalladin
TagstdTomatoExpressionMammalianPromoterCMVAvailable SinceDec. 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
mApple-Palladin-C-7
Plasmid#54934PurposeLocalization: Cytoskeleton, Excitation: 568, Emission: 592DepositorInsertPalladin
TagsmAppleExpressionMammalianPromoterCMVAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
mPlum-Palladin-C-7
Plasmid#55992PurposeLocalization: Cytoskeleton, Excitation: 590, Emission: 649DepositorInsertPalladin
TagsmPlumExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Palladin-C-7
Plasmid#55503PurposeLocalization: Cytoskeleton, Excitation: 462, Emission: 492DepositorInsertPalladin
TagsmTFP1ExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
mKO2-Palladin-C-7
Plasmid#57889PurposeLocalization: Cytoskeleton, Excitation: 551, Emission: 565DepositorInsertPalladin
TagsmKO2ExpressionMammalianPromoterCMVAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
mEos2-Palladin-C-7
Plasmid#57408PurposeLocalization: Cytoskeleton, Excitation: 505 / 569, Emission: 516 / 581DepositorInsertPalladin
TagsmEos2ExpressionMammalianPromoterCMVAvailable SinceFeb. 5, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
C31m
Plasmid#120966PurposeMoClo golden gate assembly CD part for Bxb1 integrase. See DOI: 10.1007/s00438-006-0129-5. Please see Supplemental Documents for annotated Genbank file.DepositorInsertbxb1 integrase
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
tdEos-Palladin-C-7
Plasmid#57652PurposeLocalization: Cytoskeleton, Excitation: 505 / 569, Emission: 516 / 581DepositorInsertPalladin
TagstdEosExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKPY738
Plasmid#72674PurposeC. elegans let-858 3' UTR (Gateway Entry Clone)DepositorInsertlet-858 3' UTR [From pPD129.57 (+2554 to +2960)] in pDONR P2R-P3
UseGateway entry cloneAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E189 Hs.PREX2
Plasmid#70473PurposeGateway ORF clone of human PREX2 [NM_024870.2] with stop codon (for native or N-terminal fusions)DepositorInsertPREX2 (PREX2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICSL12082
Plasmid#245652PurposeLevel 0 Golden Gate part ToxA promoter, GGAG - AATGDepositorInsertToxA promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12013
Plasmid#245630PurposeLevel 0 Golden Gate part 6GAL4UAS promoter, GGAG - AATGDepositorInsert6GAL4UAS promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
R777-E190 Hs.PREX2-nostop
Plasmid#70474PurposeGateway ORF clone of human PREX2 [NM_024870.2] without stop codon (for C-terminal fusions)DepositorInsertPREX2 (PREX2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICSL12050
Plasmid#245647PurposeLevel 0 Golden Gate part Barley Oleosin promoter, GGAG - AATGDepositorInsertBarley Oleosin promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12063
Plasmid#245649PurposeLevel 0 Golden Gate part Act2 +SSU301 Leader promoter, GGAG - AATGDepositorInsertAct2 +SSU301 Leader promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12055
Plasmid#245648PurposeLevel 0 Golden Gate part Suc2 promoter, GGAG - AATGDepositorInsertSuc2 promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12046
Plasmid#245643PurposeLevel 0 Golden Gate part SlUbi10 promoter, GGAG - AATGDepositorInsertSlUbi10 promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12014
Plasmid#245631PurposeLevel 0 Golden Gate part Act1 (OsAct) promoter, GGAG - AATGDepositorInsertAct1 (OsAct) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12015
Plasmid#245632PurposeLevel 0 Golden Gate part Ubiquitin10 (AtUbi10) promoter, GGAG - AATGDepositorInsertUbiquitin10 (AtUbi10) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12026
Plasmid#245633PurposeLevel 0 Golden Gate part Amil Chromoprotein promoter, GGAG - AATGDepositorInsertAmil Chromoprotein promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12027
Plasmid#245634PurposeLevel 0 Golden Gate part Lotus Ubiquitin promoter, GGAG - AATGDepositorInsertLotus Ubiquitin promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12039
Plasmid#245641PurposeLevel 0 Golden Gate part YAO promoter, GGAG - AATGDepositorInsertYAO promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12034
Plasmid#245639PurposeLevel 0 Golden Gate part TrpC promoter, GGAG - AATGDepositorInsertTrpC promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12038
Plasmid#245640PurposeLevel 0 Golden Gate part RPS5a promoter, GGAG - AATGDepositorInsertRPS5a promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12009A
Plasmid#245629PurposeLevel 0 Golden Gate part Ubiquitin (ZmUbi) promoter, GGAG - AATGDepositorInsertUbiquitin (ZmUbi) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12005
Plasmid#245627PurposeLevel 0 Golden Gate part lexA promoter, GGAG - AATGDepositorInsertlexA promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12040
Plasmid#245642PurposeLevel 0 Golden Gate part 35Sx2+OsMac3 5' UTR promoter, GGAG - AATGDepositorInsert35Sx2+OsMac3 5' UTR promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICSL12002
Plasmid#245626PurposeLevel 0 Golden Gate part pAt6: Ubiquitin / AtUbl5 (At5g42300) promoter, GGAG - AATGDepositorInsertpAt6: Ubiquitin / AtUbl5 (At5g42300) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12081
Plasmid#245651PurposeLevel 0 Golden Gate part pLAT52 Pollen Specific promoter, GGAG - AATGDepositorInsertpLAT52 Pollen Specific promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12030
Plasmid#245637PurposeLevel 0 Golden Gate part pAt1: Tip Delta (AT3g16240) promoter, GGAG - AATGDepositorInsertpAt1: Tip Delta (AT3g16240) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12028
Plasmid#245635PurposeLevel 0 Golden Gate part pAt2: Rib Prot16 (At4g34620) promoter, GGAG - AATGDepositorInsertpAt2: Rib Prot16 (At4g34620) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12029
Plasmid#245636PurposeLevel 0 Golden Gate part pAt5: XET (At5g65730) promoter, GGAG - AATGDepositorInsertpAt5: XET (At5g65730) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12080
Plasmid#245650PurposeLevel 0 Golden Gate part EC1.2-EN-EC1.1 Enhancer Fusion promoter, GGAG - AATGDepositorInsertEC1.2-EN-EC1.1 Enhancer Fusion promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12033
Plasmid#245638PurposeLevel 0 Golden Gate part RP27 Magnaporthe Fungal promoter, GGAG - AATGDepositorInsertRP27 Magnaporthe Fungal promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12007
Plasmid#245628PurposeLevel 0 Golden Gate part pAt3: Cysteine Synthase (At3g61440) promoter, GGAG - AATGDepositorInsertpAt3: Cysteine Synthase (At3g61440) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12001
Plasmid#245625PurposeLevel 0 Golden Gate part pAt4: AtPSBQ (At4g21280) promoter, GGAG - AATGDepositorInsertpAt4: AtPSBQ (At4g21280) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-NTAP-DmCCR4_J
Plasmid#146649PurposeInsect Expression of DmCCR4DepositorInsertDmCCR4 (twin Fly)
ExpressionInsectMutation4 silent mutations compared to the sequence given…Available SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
ACOT4A
Plasmid#42449PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pICSL12048
Plasmid#245645PurposeLevel 0 Golden Gate part Single-34S FMV (Figwort Mosaic Virus). promoter, GGAG - AATGDepositorInsertSingle-34S FMV (Figwort Mosaic Virus). promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12049
Plasmid#245646PurposeLevel 0 Golden Gate part Double (enhancer)-34S FMV (Figwort Mosaic Virus). promoter, GGAG - AATGDepositorInsertDouble (enhancer)-34S FMV (Figwort Mosaic Virus). promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG06-pLac-NRI
Plasmid#102463PurposeExpresses NRI protein in E. coli. The expression is controlled by a pLac promoter.DepositorArticleAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only