We narrowed to 41,263 results for: ANT
-
Plasmid#216796PurposeInducible bicistronic lentiviral plasmid for the simultaneous expression of the D178Y mutant form of Connexin 32 and cytosolic GCaMP6sDepositorAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pExp-His-zBasic-RBD-Avi
Plasmid#195000PurposeProduction of SARS-CoV2 receptor binding domain in E. coli with C-terminal Avi-tagDepositorAvailable SinceJan. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-DSep1-msfGFP
Plasmid#174494Purposebacterial expression of Drosophila Sep1 fused to monomeric superfolder GFPDepositorAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ287-RVR
Plasmid#138124PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized BsCas12a with N512R, K518V and N522R mutations, without promoterDepositorInsertBsCas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN512R, K518V and N522RAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ285-RVR
Plasmid#138121PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Lb5Cas12a with N512R, K518V and N522R mutations, without promoterDepositorInsertLb5Cas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN512R, K518V and N522RAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA E4-En-1 (GB2243)
Plasmid#160565PurposetRNA and scaffold for the assembly of GBoligomers for the position [4_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInserttRNA-gRNA position E4-En-1 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
GPER-DuET
Plasmid#213256PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-TP1107(Q15TAG)
Plasmid#247462PurposeBacterial expression of anti-IgG VHH clone TP1107 with amber stop codon at Q15 for unnatural amino acid incorporationDepositorInsertTP1107 Q15TAG
TagsHis6 and TEV protease cleavage siteExpressionBacterialMutationOriginal Q15 codon (CAA) was modified to amber st…PromoterT7Available SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.351.v3
Plasmid#173787PurposeMammalian expression of SARS-CoV-2 Spike protein South African variant version 3DepositorInsertSpike (S-GSAS-B.1.351 variant version 3) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only