We narrowed to 1,885 results for: BRE
-
Plasmid#238370PurposeExpresses the RGG3 (549-638) region from the RNA-binding protein EWSDepositorInsertEWSR1 (EWSR1 Human)
Tags10xHis-MBPExpressionBacterialMutationdeleted amino acids 1-548PromoterT7Available sinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAG8Ha-EWS_RRM(359-447)
Plasmid#188045PurposeExpresses His8-EWS_RRM(359-447) with a TEV site for removal of the His8 tag.DepositorInsertEWSR1 (EWSR1 Human)
TagsHis8ExpressionBacterialMutationdeleted amino acids 1-358, 446-656PromoterT7Available sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-Ef1A-Myc-POLB(PAMmut)
Plasmid#176150PurposeN-terminus Myc-tagged POLB containing a mutation in the PAM site used by POLB gRNA1 & a hygromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsMYCExpressionMammalianMutationMutation in the PAM site used by POLB gRNA1PromoterEF1AAvailable sinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1893-1
Plasmid#105248Purposehuman GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)DepositorInsertInsertion of GFP11 at cut tagRFP 33bp downstream (recoded *) in Lamin A/C (LMNA Human)
ExpressionBacterialAvailable sinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV2_hSyn_Aurora_CA_Citrine
Plasmid#98219PurposeSlow cycling (open for minutes) step-function artificial anion conducting channelrhodopsin (aACR). High light sensitivity. Activation with green light, inactivation max with 625 nm (accelarates closure to ms). Not recommended for in vivo use. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Aurora_C128A gene
UseAAVTagsCitrineExpressionMammalianMutationV59S, E83N, E90Q, E101S, V117R, E123S, C128A, P24…Promoterhuman synapsinAvailable sinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
FLAG-mPar6a K19A
Plasmid#86149PurposeFLAG-mPar6a K19A - Does not bind to aPKCDepositorInsertPar6 (Pard6a Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationLysine to Alanine mutation K19APromoterLTRAvailable sinceMarch 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1Xpress-AbrR683AN795A-HisC
Plasmid#32510DepositorAvailable sinceFeb. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRP[Exp]-CAG>dme_Syb[NM_001144161.2](ns):3xGGGGS:EGFP
Plasmid#248617PurposeC-terminal GFP tag for GOIDepositorAvailable sinceAug. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Myc-HECT(TRIP12)
Plasmid#216767PurposeMyc-HECT(TRIP12); the HECT domain (AA 1651-2040) of TRIP12 with an N-terminal Myc-tagDepositorInsertMyc-HECT(TRIP12) (TRIP12 Human)
UseCloning vectorTagsMycExpressionMammalianMutationHECT domain of TRIP12 (amino acids 1651-2040)Available sinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Myc-HECT(C2007A)
Plasmid#216783PurposeMyc-HECT(TRIP12); the HECT domain (AA 1651-2040) of TRIP12 with an N-terminal Myc-tag; AA C2007 changed to ADepositorInsertMyc-HECT(TRIP12) (TRIP12 Human)
UseCloning vectorTagsMycExpressionMammalianMutationHECT domain (amino acids 1651-2040); aa C2007 cha…Available sinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Myc-HECT(C2007)-Puro
Plasmid#216784PurposeMyc-HECT(TRIP12); the HECT domain (AA 1651-2040) of TRIP12 with an N-terminal Myc-tag & a puromycin resistance cassette; AA C2007 changed to ADepositorInsertMyc-HECT(TRIP12) (TRIP12 Human)
UseLentiviralTagsMycExpressionMammalianMutationHECT domain (amino acids 1651-2040); aa C2007 cha…Available sinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Myc-HECT(TRIP12)-Puro
Plasmid#216770PurposeMyc-HECT(TRIP12); the HECT domain (AA 1651-2040) of TRIP12 with an N-terminal Myc-tag & a puromycin resistance cassetteDepositorInsertMyc-HECT(TRIP12) (TRIP12 Human)
UseLentiviralTagsMycExpressionMammalianMutationHECT domain of TRIP12 (amino acids 1651-2040)Available sinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Myc-HECT(TRIP12)-Hygro
Plasmid#216773PurposeMyc-HECT(TRIP12); the HECT domain (AA 1651-2040) of TRIP12 with an N-terminal Myc-tag & a hygromycin resistance cassetteDepositorInsertMyc-HECT(TRIP12) (TRIP12 Human)
UseLentiviralTagsMycExpressionMammalianMutationHECT domain (amino acids 1651-2040)Available sinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-HA-PARP1-3GS-TurboC
Plasmid#248158PurposePARP1 with split TurboID at C-termDepositorAvailable sinceJan. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR V2 Hygro sgIKBKG_1
Plasmid#241449PurposeDelete IKBKGDepositorAvailable sinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR V2 Hygro sgIKBKG_2
Plasmid#241450PurposeDelete IKBKGDepositorAvailable sinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-ITGB1-V1
Plasmid#215454PurposeExpression vector with integrin beta1 tagged with the BiFC V1 fragmentDepositorInsertITGB1 (ITGB1 Human)
TagsVenus fragment 1 (V1)ExpressionMammalianMutationSilent mutations added to disrupt shRNA binding a…PromoterCMVAvailable sinceNov. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEF.DEST51-PTPN11(D425A,C459S)-Clover
Plasmid#215526PurposeExpression vector with a clover-tagged phosphatase-inactive Shp2 mutant (D425A,C459S)DepositorInsertPTPN11 (PTPN11 Human)
TagsCloverExpressionMammalianMutationD425A, C459S (Phosphatase inactive)PromoterEF1aAvailable sinceSept. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR2b-PTPN11(D425A,C459S)-Clover
Plasmid#215520PurposeGateway entry vector with a clover-tagged phosphatase-inactive Shp2 mutant (D425A,C459S)DepositorInsertPTPN11 (PTPN11 Human)
UseGateway CloningTagsCloverMutationD425A, C459S (Phosphatase inactive)PromoternoneAvailable sinceSept. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits