We narrowed to 7,531 results for: ski
-
Plasmid#160806PurposeExpress ISC mutant POLD1DepositorInsertPOLD1 ISCmut (POLD1 Human)
UseRetroviralMutationCodon optimized C-terminal 230 amino acids, C1058…Available SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Lyn-SH2-AviTag
Plasmid#214207PurposeBacterial expression of SH2 domain of the Lyn kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-TEV-Grb2-SH2-mCherry-AviTag
Plasmid#214231PurposeBacterial expression of SH2 domain of the Grb2 with N-terminal TEV-cleavable 6xHis tag, C-terminal mCherry, and C-terminal AviTag for Streptavidin bead functionalization for binder selections.DepositorInsertGrb2 SH2 domain (GRB2 Human)
Tags6xHis, AviTag, and mCherryExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Lck-SH2-AviTag
Plasmid#214203PurposeBacterial expression of SH2 domain of the Lck kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertLck kinase SH2 domain (LCK Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Blk-SH2-AviTag
Plasmid#214204PurposeBacterial expression of SH2 domain of the Blk kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertBlk kinase SH2 domain (BLK Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Hck-SH2-AviTag
Plasmid#214206PurposeBacterial expression of SH2 domain of the Hck kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
PAX3::FOXO1-2A-sfGFP
Plasmid#240098Purposehuman PAX3::FOXO1 in -2A-sfGFP backbone (Plasmid# 74668)DepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-TAZ-CAMTA1
Plasmid#235681PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the doxycycline-inducible TRE promoterDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAK-DR30(SapI)-hfCas13d-Puro-pA/EF1A-mCherry-WPRE-pA
Plasmid#233046PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d and a Puro resistance gene. It also encodes an mCherry gene. The CasRx and Puro coding regions are separated by a T2A site.DepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d and mCherry
TagsmCherryExpressionMammalianAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAK-DR30(SapI)-CasRx-Puro-pA/EF1A-mCherry-WPRE-pA
Plasmid#233045PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx and a Puro resistance gene. It also encodes an mCherry gene. The CasRx and Puro coding regions are separated by a T2A site.DepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx and mCherry
TagsmCherryExpressionMammalianAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-GPI_sgRNA2
Plasmid#201595PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertGPI (GPI Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-3g-EEA-2g-PGK-Puro
Plasmid#201677PurposeEBNA episome plasmid for U6 promoter-driven expression of 3 gRNAs targeting miRNA302/367 (Addgene #201960) and 2 gRNAs targeting EEA-motif (Addgene #102898). Includes PGK-puro selection cassetteDepositorInsertMIR302-3g-EEA-2g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV Cdk2ap1ΔN (MT2B2)-HA
Plasmid#178031PurposeRetroviral vector for the purpose of overexpression in mammalian cell cultureDepositorInsertCdk2ap1 (Cdk2ap1 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationFirst N-Terminal 27aa are deletedPromoterGAGAvailable SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLA1 ISCmut
Plasmid#160808PurposeExpress ISC mutant POLA1DepositorInsertPOLA1 ISCmut (POLA1 Human)
UseRetroviralMutationCodon optimized, C1354S, C1359S, C1377S, C1380SAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iGluSnFR3.v857.PDGFR
Plasmid#178333PurposeFluorescent reporter for glutamate, third generation, variant 857. iGluSnFR3.v857DepositorInsertpAAV CAG iGluSnFR3 v857.PDGFR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and PDGFR TM DomainExpressionMammalianAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFR3.v857.PDGFR
Plasmid#178329PurposeFluorescent reporter for glutamate, third generation, variant 857. iGluSnFR3.v857DepositorHas ServiceAAV1InsertpAAV hSyn iGluSnFR3 v857.PDGFR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and PDGFR TM DomainExpressionMammalianAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGGG-AH-VRT-A2
Plasmid#163703PurposeWheat transformation vector pGoldenGreenGate (pGGG) with OsActinP:: hygromycin (hpt) selection and the full native Triticum polonicum VRT-A2 gene (native prom::genomic seq::3'UTR)DepositorInsertsOs Actin promoter :: Hygromycin resistance gene (hpt) containing CAT1 intron :: NosTerminator
Triticum polonicum VRT-A2 genomic sequence (Native promoter:: genomic sequence::3'UTR) + Nos Terminator
ExpressionPlantPromoterRice - Os Actin promoter and Triticum polonicum V…Available SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only