We narrowed to 13,309 results for: sequence
-
Plasmid#113946Purposemammalian expression plasmid for c-myc-tagged human T1R2 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R2 (TAS1R2 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 22-839Available SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTT3 Flrt1-myc
Plasmid#72191PurposeExpress full-length Flrt1 with a C-terminal myc tagDepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-GRM3-VN
Plasmid#98965PurposeFLAG-tagged human mGluR3 fused to N-terminus of split VenusDepositorInsertGRM3 (GRM3 Human)
TagsFLAG (dykddddk) epitope tag, Signal/leader sequen…ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
MmEos3.2
Plasmid#203754PurposeEncodes the membrane anchor of Src including the first 15 resideues of the N terminus, with 1 myristoylation and short polybasic sequence, with mEos3.2 fused to the C terminus. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAG876 pDisplay-pFAST
Plasmid#172868Purposeexpresses pFAST at the surface of mammalian cellsDepositorInsertpFAST-PDGFR
TagsIgK leader sequence (N terminal on insert) and My…ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
MCUabaa-Flag-PLYS1
Plasmid#236786PurposeMCU-MCUB fusion in abaa pattern. Only the initial MCU has a mitochondrial targeting sequence.DepositorUseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MCUabab-Flag-pLYS1
Plasmid#236788PurposeMCU-MCUB fusion in abab pattern. Only the initial MCU has a mitochondrial targeting sequence.DepositorUseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EMTB-TurboID-V5-puro
Plasmid#190741PurposeA lentiviral plasmid encoding EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)DepositorInsertEMTB-TurboID-V5 (RPS14 Human, EMTB is human ensconsin; TurboID is engineered BirA from E.coli)
UseLentiviralTagsMycExpressionMammalianMutationMicrotubule binding-domain of ensconsin (amino ac…PromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only