We narrowed to 13,309 results for: sequence
-
Plasmid#72085PurposeExpresses the extracellular region of the LRRC4C protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only
-
human ETV6 gRNA-1
Plasmid#133353Purposehuman ETV6 gRNA-1 is a gRNA expression plasmid. Its 20-nt specific sequence targets the first ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Dscaml1-Fc-His
Plasmid#72072PurposeExpresses the extracellular region of the Dscaml1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna5-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128340PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-BLMP-1-pcDNA3.1-
Plasmid#52512Purposeexpresses C. elegans BLMP-1 in mammalian cells with FLAG-HA tag at N-terminusDepositorInsertBlmp-1 (blmp-1 Nematode)
TagsFLAG-HAExpressionMammalianMutationN75S mutation compared GenBank reference sequence…PromoterCMVAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG NBT:NRGIIIa:polyA
Plasmid#193012PurposeTol2 transgenic construct that will express human Neuregulin1 Type IIIa in neuronsDepositorAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-GAP43-ECFP-stop-L2
Plasmid#186356PurposeEntry clone with ORF encoding plasma membrane-targeted GAP43-eCFP flanked by Gateway recombination sequencesDepositorInsertGrowth-associated protein-43 (Gap43 Synthetic, Mouse)
UseExpression of a fluorescent membrane markerTagsECFPAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1136200-bio
Plasmid#47730PurposeExpresses enzymatically monobiotinylated full-length PF3D7_1136200 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PF3D7_1136200
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin replaced…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only