Skip to main content
Addgene

We narrowed to 101 results for: Myc-tagged Cre

Showing: 1 - 50 of 101 results
  1. Of Myc and Men

    Type
    Blog Post
    ...   Myc1-9E10 and the Myc-tag today Since Munro and Pelham introduced the Myc tag to the world, it...commonly used Myc-tag. Who first started using it in protein tagging experiments? Why Myc? When did the...explore… the life and times of the myc tag.  Origins of protein tags For about as long as the disciplines... Find recombinant anti-c-Myc [9E10] at Addgene Find plasmids with the myc-tag  ...antibodies against the Myc tag have been generated in an attempt to overcome some of Myc1-9E10’s shortcomings...probe the functions of the human c-Myc gene (Evan, et al. 1985). Myc was one of the earliest identified...for protein tagging approaches” was not part of the goal when Evan’s team generated their Myc antibodies...
  2. Hot Plasmids - October 2022

    Type
    Blog Post
    ...guess that the Myc-tag is one of them (and not just because of the title!) The Myc-tag is a string of ...proto-oncogene c-Myc. Since the generation of the first anti-c-Myc [9E10] (Even, et al., 1985), the Myc tag has become...doi.org/10.1101/2021.09.17.460684.)   Myc-tag antibody anti-c-Myc [9E10] now available! by: Ashley Waldron...detecting protein tags.  And when you think of protein tags, what are the first tags that come to mind...of the most commonly used protein tags - a quick search for ‘Myc tag’ in the Addgene catalog pulled up... of Addgene’s western blot for the myc-tagged protein GFP-smFP-myc expressed from Plasmid 98926. See the...Improved voltage indicator: JEDI-2P Novel class of light-gated potassium channelrhodopsins Myc-tag antibody...
  3. Antibodies 101: Epitope Tags

    Type
    Blog Post
    ...purification tag blog!).   Applications of epitope tags   The tags A number of epitope tags exist...monoclonal (M2) as well as a chimera (rabbit). Myc The Myc tag is a 10 amino acid peptide (EQKLISEEDL) derived...guidance on designing a GFP tag Addgene has you covered!   Potential tag issues Tags have a lot of major benefits...fix your antibody woes.   What are epitope tags? Epitope tags are short peptides introduced at the N or...system. Tagging can also aid in protein purification! In this blog, though, we are focusing on tagging for...amino acids on the C terminal of the tag. Of the most common tags, FLAG is the most charged, with 5 negatively...charged and 1 positively charged amino acids. Myc tags are frequently used for western blot, flow cytometry...
  4. RANbodies: Reporter Nanobody Fusions

    Type
    Blog Post
    ...Spaghetti Monsters are highly antigenic tags that have 10 HA or 10 MYC tags built into a GFP scaffold. Some GFP... secondary antibody staining HA Tagged GFP, RFP, H2A2B Myc Tagged RFP, H2A2B Chicken IgY (Y) Labeled...RANbody is detectable by two different tags: a reporter and an HA tag. The reporter comes in three varieties...Spaghetti Monster tagged RANbodies can be detected either with a labeled anti- HA or -MYC antibody or with... Spaghetti Monster: HA (H) or Myc (M) versions Labeled anti-HA or -Myc antibody Staining cultured cells...lot-to-lot variability in activity. No Genetic Tagging - Since antibodies are produced in animals instead... via recombinant DNA, they can’t be genetically tagged and instead are conjugated to reporters (i.e. fluorescent...
  5. Inntags: Innovative Protein Epitope Tagging

    Type
    Blog Post
    ...Why do we need new epitope tags? Short epitope tags like FLAG, HA, and Myc can adopt a number of different...the effects of GFP fusions to inntags or traditional FLAG, HA, and Myc tags. Impressively, IT6-GFP did not... looking to a tag a protein, inntags IT5 and IT6 are a great place to start. These tags are easy to use... about other Protein Tags in our Plasmids 101 Series. Get the Inntag Plasmids Tag endogenous proteins ...major caveat - a tag may interfere with protein localization and/or function, so each tagged protein must ... Aldea and collaborators have created a set of “innocuous tags” (inntags) less likely to alter a protein...proteins found that 20% of tagged proteins did not localize similarly to their untagged counterparts. These ...
  6. Mycoplasma Contamination: Where Does It Come From and How to Prevent It

    Type
    Blog Post
    ...PCR based detection, DNA staining, fluorescent tagging, agar plating, etc. Be wise to choose any of the...you encounter mycoplasma contamination. Causes of mycoplasma contamination The mycoplasmas enter the cell...antibacterial drugs like penicillin and streptomycin. Mycoplasma can pass through filtration methods because...cell cultures are kept will increase the risk of contamination. Mycoplasmas can spread from these sources... growth of mycoplasmas. The serum is nutrient-rich and also the best source for mycoplasma proliferation...suppress the growth of mycoplasma but cannot eradicate it completely. When mycoplasmas are seen in the culture...highly expensive). Detecting mycoplasma contamination Detection of mycoplasma by naked eyes or optical microscope...
  7. No Llamas Required - Synthetic Nanobodies Against Membrane Proteins

    Type
    Blog Post
    ...which attaches a Myc-tag and a His6-tag to the end of each sybody candidate. These tags are used in a final...starts out with anti-Myc antibodies bound to an ELISA plate to capture Myc-tagged sybodies. Then, the ...pBXNPHM3 expression plasmids for the production of tag-free proteins for further characterization and analysis...Walter et al., 2020). No llamas required. The advantages of synthetic nanobodies Nanobodies are small ...to, like ones that are hidden in the molecular crevices proteins on the cell surface. Figure 1: ...threonines at positions that can be randomized for creating the libraries (Zimmermann et al., 2018). Find ...step using ribosome display because it has the advantage of starting out with a larger initial starting...
  8. pCXLE toolkit: Efficient episomal plasmid-based method to reprogram peripheral blood cells to iPSCs

    Type
    Blog Post
    ...replacing C-MYC with L-MYC in the episomal reprogramming cocktail by Okita et al. increased the reprogramming...enhances iPSC generation as does replacing C-MYC with L-MYC [10, 11]. While the mechanisms underlying the...reprogramming factors- OCT3/4, SOX2, KLF4, and C-MYC [1]. For the derivation of clinical grade hiPSCs,...that encoded six factors - OCT3/4, SOX2, KLF4, C-MYC, LIN28 and SV40 large T antigen (SV40LT). The method...pCXLE-hSK 27078 SOX2 and KLF4 pCXLE-hUL 27080 L-MYC and LIN28 pCXLE-hOCT3/4-shp53-F 27077 OCT3/4 and...direct reprogramming by transformation-deficient Myc. Proc Natl Acad Sci U S A, 2010. 107(32): p. 14152...hiPSCs than age-matched fibroblasts [3]. These advantages make PBMCs the ideal source of somatic cells ...
  9. Plasmids 101: Protein tags

    Type
    Blog Post
    ... cleavage tags Frequently, a single tag is not enough. What if you need one tag to increase solubility...to fuse an affinity tag to it. The FLAG, hemaglutinin antigen (HA), and c-myc tags have been the workhorses...affinity tag is the polyhistidine (His) tag. Small and unlikely to affect function, His-tagged proteins...greatly alter the size of the tag.   Table 1: Common protein tags Tag Epitope Mass (kDa) Function Notes...to all tags, but rather a quick overview of why scientists use tags, with a few time-tested tags and fusion...protein. Unlike other epitope tags – which when doubled or tripled increase the tag size quickly – modifying...you generally don’t want more tag than protein), 2-3 tags is increasingly common. Tandem affinity purification...
  10. Hot Plasmids and Viral Preps - September 2021

    Type
    Blog Post
    ...genome-wide. It was designed based on MYC-ChIP-seq data from several MYC-dependent cancer cell lines. It can...selection marker, Thy1.1, in addition to puromycin resistance.  The MYC-CRISPR library targets E-boxes genome-wide... can be applied for identification of essential MYC binding sites in a wide range of human cells.  A new...’s lab previously developed such a system in Streptomyces, a prokaryotic genus capable of producing a ...different biochemical secondary energy sources to increase protein yields from 36 μg/mL to 266 μg/mL. The...oxytetracycline enzymes. Next, this system was used to recreate natural biosynthetic pathways. Biosynthetic pathways...Cas13Y, two compact Cas13 proteins found in the metagenome datasets from hypersaline samples, were engineered...
  11. Antibodies 101: Affinity Tags

    Type
    Blog Post
    ...different types of tags, including epitope tags (FLAG, Myc, etc.) and fluorescent protein tags (GFP, mCherry... His-tagged protein purification work flow by nickel column.    Affinity tags vs. other tags There.... The MBP tag, although large, can actually increase expression and solubility of the tagged protein (...planning, affinity tags can make protein purification a cinch. Types of affinity tags, the proteins they...are all reviewed here. What are affinity tags? Affinity tags are used primarily as protein purification... common tags available. Maltose binding protein Maltose binding protein (MBP) is a 45 kDa tag which can...cleavage at sites immediately following the tag. Unlike MBP, the GST tag can be cleaved off from the fusion protein...
  12. The Developmental Studies Hybridoma Bank: Over 25 Years of Antibody Sharing

    Type
    Blog Post
    ...proteins (GFP and YFP) and protein tags (c-MYC and HA). We have also created the Monoclonal Antibody Research... associated hybridoma cell lines. The DSHB was created by the National Institute for Child Health and ... which are each produced by a single B cell. To create a monoclonal antibody cell line, myeloma cells ...individually isolated and expanded. The clonal cells are screened to identify hybridoma lines, each producing a ...partially humanized rabbit antibodies that exhibit increased avidity to high profile antigens; and 4) generating...
  13. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...in plants Myc Epitope tag pKMyc - N-terminal Myc tag for mammalian expression pGEX-4T-1-3xMyc - Bacterial...Bacterial vector for Myc tag pETcon(-) - Yeast surface display vector with a C-terminal Myc tag pPMW-attB - pUASp... with N-terminal Myc tag and attB for Drosophila transgenesis His Epitope tag pEZYmyc-His - C-terminal...fusion protein. Read more about epitope tags and protein tags . Tag or Fusion Protein Common uses...collection page Return to top Epitope Tag or Fusion Protein Tags and fusion proteins are excellent tools...stop codon for C-terminal tags and omit the start codon for N-terminal tags. And when you are designing... C-terminal tagging in S. cerevisiae pCS2FLAG - N- or C-terminal 2xFLAG tag in pCS for ...
  14. Fluorescent Tagging of Endogenous Genes with SapTrap

    Type
    Blog Post
    ...T2A-TurboGFP-PEST), and small epitope tags (HA, Myc, Strep tag II, AviTag, HaloTag, SpyTag). The Foerstemann lab developed... scarless tag insertion.   In addition to the obvious advantages SapTrap offers for tagging a single genetic...insertion tagging), developed by the Hornung Lab, allows users to easily create C-terminal tag fusions ...between the tag and homology arms). Digestion of the donor plasmids with SapI allows the tag, selectable...genetic tag and marker sequence into the targeted loci. The selectable marker can be removed by Cre-mediated... inserting a tag at multiple target sites. SapTrap vectors can be easily modified to tag hundreds of genes...endogenous protein tagging, please visit our website CRISPR/Cas Plasmids - Protein Tagging. Beyond simply...
  15. Synthesized by Ginkgo Bioworks, Shared by Addgene: SARS-CoV-2 Plasmids for Many Expression Systems

    Type
    Blog Post
    ..., codon optimized, untagged, cleavage sites (thrombin and TEV), and C-terminal tags (StrepII, 3xFLAG, ..., 6xHIS, MBP, Myc). These constructs include proteins like nonstructural proteins 1 to 16, spike proteins...expression constructs contain protein coding genes, tags, truncations, and codon optimizations similar to... downstream experiments and offer flexibility in tag, cleavage, codon usage, and expression system. Mammalian...expression vector are also available. These contain no tags and are intended to be used in the production of...sequencing by NGS. Addgene’s QC scientists immediately screen these plasmids to confirm they contain the expected...of plates will have select samples prepared and screened by NGS to spot check the samples, the rest will...
  16. Plasmids for Stem Cell Research

    Type
    Collection
    ...Human Fluorescent-tagged EBNA1-mediated expression of human Oct3/4, shp53, Klf4, Sox2, L-Myc, Lin28 from separate... plasmids that can be used to create cell lines with endogenously-tagged gene variants or browse Addgene...state using a cocktail of factors (Oct3/4, Sox2, c-Myc, and Klf4) that are known to maintain pluripotency...Lentivirus Human Expression of human Oct4, Sox2, Klf4, Myc, and Brd3R from five separate lentiviral plasmids...Doxycycline-inducible expression of human Oct4, Sox2, Klf4, and c-Myc from four separate lentiviral plasmids A drug-inducible... the expression of human Oct4, Klf4, Sox2, and c-Myc Human Induced Pluripotent Stem Cells Produced Under...vector for the expression of human Oct4, Klf4, c-Myc, and Sox2 Integrative Analyses of Human Reprogramming...
  17. Neuronal labeling with Spaghetti Monster

    Type
    Blog Post
    ...antibody recognition of epitope tags. Thus they have created antigenic protein tags called “spaghetti monster...strep-tag and, more recently, OLLAS (Escherichia coli OmpF linker and mouse langerin) and Sun Tag (Viswanathan...antibodies can have low affinity for these tags and even multimeric tags are frequently insufficient for detection...FP and epitope tags, researchers in Loren Looger’s lab have developed new molecular tags combining the ...Viswanathan, 2015). The principal advantage of epitope tags for IHC is the availability of reliable primary... are unavailable entirely. The other advantage is that these tags are small (8-12 amino acids) and neither...composed of FPs fused to multiple epitope tags. Indeed, to create the smFPs Looger’s team strategically inserted...
  18. Hot Plasmids February 2024

    Type
    Blog Post
    ...anti-FLAG tag antibodies By Ashley Waldron Of all the epitope tags we know and love, the FLAG tag (amino ...Endothelial-specific AAV delivery Recombinant anti-FLAG tag antibodies Peptide-assisted genome editing for ...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP. B... purify or image a recombinant protein, the FLAG tag has proven itself a good option for essentially all...collection includes over 10,000 plasmids with a FLAG tag (!), but did you know that we distribute ready-to-use...  Neurogenetic alchemy: CAP-Mac unleashes the secrets of primate brains with brilliance By Hridaya Patel...authors used a multispecies approach to generate and screen a library of AAV9 variants (Chuapoco et al., 2023...
  19. Delivery Methods for Generating iPSCs

    Type
    Blog Post
    ... viral particles that express oncogenes, such as Myc. Viral vectors also have the largest genomic footprint...transgenes is a concern as well, and reactivation of Myc or other oncogenes after differentiation has been...formation in iPSC-derived and iPSC-transplanted mice. Cre-deletable or Tet-inducible lentiviruses address some...considered safe for clinical applications. Excisable Cre-lox lentiviral vectors: This approach is the same...standard lentiviral vector, but transient expression of Cre recombinase allows for deletion of the inserted transgenes...including reporters and RNAi) for:  NANOG  OCT4 SOX2 MYC KLF4 LIN28 Check out these plasmids if you’re interested...due to the risk of insertional mutagenesis. Random integration also creates heterogeneous iPSC cell lines...
  20. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ... been deposited with Addgene and include MYC- and FLAG-tagged TZAP constructs (wild-type and truncation...nonoverlapping emission spectra (N- and C-terminal tags for mTagBFP, TagRFPt, EGFP, mVenus, mCerulean3, mKOFP2) and... transcription factors OCT3/4, SOX2, KLF4, and c-MYC is the established model for reprogramming somatic...instance, inserting PhoCl in between a protein and a tag, such as an NLS or NES, enables control over localization...light-dependent Gal4 transcriptional activation and Cre recombination. Find PhoCl plasmids at Addgene. Zhang... for easy removal of the resistance cassette via Cre recombination. Each knockout includes unique barcodes...gRNAs used for TZAP gene editing, and a Hi6xs-MBP tagged TZAPznf9-11constructs used for bacterial expression...
  21. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...-Rab11a-c-Myc Recycling endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Recycling...Voeltz 79802 pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc...Mothes 79806 pTag-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-...endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagBFP James Johnson...pTag-BFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagBFP James Johnson 13050 DsRed-Rab5 WT Early endosomes RAB5A DsRed2...Plasmids encoding fluorescent proteins tagged with genes or peptides with known subcellular localization... NLS mKalama1 Robert Campbell 73205 pcDNA3.1-NLS-myc-dL5-2xG4S-mCer3 Nucleus NLS (from Mak16p protein)...
  22. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pCMVTNT PINK1 N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's...Ultra-Exon1Q23-Myc-A HTT Myc UbC Huntington's Baoji Xu 110487 Ultra-Exon1Q145-Myc-A HTT Myc UbC Huntington's...pUltra-Exon1Q23-Myc-B HTT Myc UbC Huntington's Baoji Xu 110489 pUltra-Exon1Q145-Myc-B HTT Myc UbC Huntington's...Strep-Lrrk2-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161583 pPuro3.1(+)_Strep-Lrrk2-Myc LRRK2 Myc, Strep...ataxia Ronald Kahn 11443 pBS human Frataxin (myc tag) FXN Myc T7 Friedreich ataxia Ronald Kahn 11487 pET32a-HD16Q...LRRK2-WT LRRK2 His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted ... pGW1-Myc-DJ1-WT PARK7 V5 CMV Parkinson's Mark Cookson 29349 pGW1-Myc-DJ1-L166P/K130R PARK7 Myc CMV Parkinson's...
  23. Luciferase Plasmid Collection

    Type
    Collection
    ...NanoLuc® with either SNAP‐tag or HaloTag7 tag in which labeling of the self‐labeling tag with a fluorophore ...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (neo...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...less-than-ideal protein tags due to their large size. NanoLuc® Luciferase is small, bright, and a secreted version of...biosensor that utilizes Renilla luciferase and a Halo tag to assay mRNA decay in real time. pKC-4.04, pKC-4.06...PI 60226 AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Renilla EF1α AAV9-CRISPR knockout ...Lentiviral expression of firefly luciferase with a V5 tag Kevin Janes 83281 pAAV-CAG-FLuc Firefly CAG AAV expression...
  24. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ... cells. Flexible tagging: Choose untagged or add a versatile N- or C-terminal HA tag. Selectable and stable...Key elements (promoter, tag, polyA site) are flanked by unique restriction sites so you can swap sequences...plasmid set, our bacterial plasmid set for expressing tagged proteins, and stay tuned for mammalian expression...known regulators at the FOS gene promoter and the MYC locus (Figure 5). Figure 5: TurboCas protein...streptavidin immunoprecipitation (IP), and tandem mass tag (TMT) mass spectrometry (MS) in HCT116 cells (colorectal... stable: A puromycin resistance gene makes stable cell line creation a breeze. Modular by design: Key ...lentiviral supernatant and selected with puromycin. Puromycin-resistant cells were fixed and labeled with...
  25. Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein

    Type
    Blog Post
    ...is to tag the protein of interest with a small biochemical “epitope tag” such that these tagged proteins... the tagging efficiency in the transfected cells, we count the number of tag-positive cells (tag ICC) ...crRNA and/or try out an alternative tag (3xFLAG, Myc, V5, or HA). Tag-specific PCR genotyping can tell if...endogenous gene tagging in human cells Plasmids 101: Protein Tags Fluorescent tagging of endogenous genes...each with a different tagged protein of interest, and a universal all-purpose “tag antibody” can be used...projects that require epitope tagging of a large cohort of genes (e.g. tagging genes representing a protein...pipeline for epitope tagging. Using our 96-format pipeline, we can routinely achieve 5-30% tag knock-in efficiency...
  26. Zebrafish Plasmid Collection

    Type
    Collection
    ...Knock-in tagging - Michel Bagnat lab. Targeting cassettes encoding fluorescent proteins for tagging genes...bearing either amino- or carboxyl-terminal tags, including Myc, HA, Flag, GST and eGFP epitopes. Zebrafish...resistant cell types. CreLite - George Eisenhoffer Lab. An optogenetically controlled Cre/loxP system that ...toolbox of genetic methods, such as Tol2 transposons, Cre-mediated site-specific recombination, morpholinos...fluorescent proteins, reporters, biosensors, and Cre expression plasmids. Large collections or kits are...that are amenable to genetics, high-throughput screening and non-invasive live imaging. A standard toolbox...Keith Joung Lab CRISPR/Cas9-based conditional mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9...
  27. Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2:  Reprogramming and Transdifferentiation

    Type
    Blog Post
    ...dedifferentiation stage involves overexpression of four reprogramming factors- OCT4, SOX2, KLF4, and C-MYC - that...More (due to additional pluripotency stage) Less Safety Less (C-MYC, a known oncogene is one of the reprogramming...transdifferentiated in vivo to pancreatic β-like-cells with the expression of pancreatic and duodenal homoeobox...lineage, without dedifferentiating into a pluripotent stage. Cellular reprogramming The reversal of a differentiated...reprogramming [1]. The process can be divided into two stages: Dedifferentiation - Conversion of adult somatic...differentiated somatic cell to revert back to a pluripotent stage (iPSC formation) [2, 3]. The iPSCs then proliferate...reprogrammed to iPSCs successfully [10-12]. The next stage of reprogramming consists of redifferentiation of...
  28. Sequencing Primers

    Type
    Guide
    ...promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT... TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer HAT GAGGAGCACGCTCATGCCCAC...Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT...Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen) CYC1... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end...
  29. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular tag, the IT6...production of a new series of epitope tags, inntags (innocuous tags), that they believe will have fewer ...expressed either without a tag or as multiple fusions with different N- and C-terminal tags. Additionally, by ...Unfortunately, while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause ...expression of fusions between the POI and a TAP tag (a tag with two epitopes that can be used to sequentially...the POI-tag fusion from a plasmid or from a random genomic location than to express the tagged protein...two dimeric Broccoli tags (2xdBroccoli) to further enhance fluorescence of the tagged RNA. Bacterial and...
  30. Starter guide to induced pluripotent stem cells (iPSCs) part 1:  A renaissance in regenerative medicine

    Type
    Blog Post
    ...of four embryonic genes- OCT4, SOX2, KLF4, and C-MYC. iPSCs were first generated from mouse fibroblasts...which combined the advantages of both while limiting disadvantages led to the creation of induced pluripotent...therapeutic purposes. Both types have their advantages and disadvantages. Here is a table listing some of them...cells found in the zygote through to the morula stage are totipotent [2-4]. Pluripotency: When a cell ...research. With all these benefits, iPSCs have increasingly become the ideal experimental system for research... Induced Pluripotent Stem Cells: Problems and Advantages when Applying them in Regenerative Medicine. ...
  31. Cre-lox system

    Type
    Collection
    ...recombinant Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc CAG Mammalian Cepko 13776 pCAG-Cre:GFP Cre-GFP fusion...-CW-CRE Cre CMV Lentiviral Trono 12265 pHR-CMV-nlsCRE Cre CMV Lentiviral Trono 12493 p259 pCMV-CRE-M (...13777 pCAG-ERT2CreERT2 ERT2-Cre-ERT2-Tamoxifen inducible CAG Mammalian Cepko 13779 pRho-Cre Cre-Myc rhodopsin...pOG231 NLS-Cre CMV Mammalian Wahl 19131 pIC-Cre Cre Bacterial Rajewsky 22776 MSCV CreERT2 puro Cre-ERT2 - ...mCherry-P2A-Cre Cre CMV RABV Jessell 73474 RabV CVS-N2c(deltaG)-Cre Cre CMV RABV Jessell 73717 pMLS328 Cre eft...comparison of Cre+ and Cre- cells. While Cre-lox recombination is a very useful tool, Cre expression can...pPGK-Cre-bpA Cre PGK Mammalian Rajewsky 11916 pBS185 CMV-Cre Cre hCMV Mammalian Sauer 11918 pBS513 EF1alpha-cre Cre...
  32. How to Write a Scientific Review Article

    Type
    Blog Post
    ...you can sound credible and cool when you casually mention “Haery et al., showed that MYC expression was...was increased…” when discussing the review topic with your peers. Start reading! I started by reading ...retreat to the woods for months at a time, so take advantage of whatever time you have. If you’re like me, ...will also paraphrase what I have heard many other creative people say about writing: you don’t know what ...
  33. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions. Kim, et al. Mol Biol Cell. 2016. ...for an individual tagging event. Commonly used sequences, including fluorescent tags, a floxed Cbr-unc...proteins are tagged with Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly ...efficiency of screening for protein–protein interactions. The Roux lab has deposited HA tagged BioID2 for...through a large-scale expression screen that can be used to generate His-tagged human kinase constructs that...loxP-stop-loxP cassette into the Rosa26 locus, allowing for Cre-dependent expression of a GMAP inserted gene. The...technology. To streamline CRISPR/Cas9-based genetic tag insertion in the C. elegans genome, Erik Jorgensen...
  34. Molecular Biology Reference

    Type
    Guide
    ... Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST...nucleotides. Epitope tags on the other hand are commonly used in molecular cloning to tag a gene within a ...random incorporation of modified, fluorescently tagged bases onto the growing DNA strand in addition to...T, C, or G nucleotide. The 4 standard bases are tagged with a different fluorophore so they can be distinguished...when the polymerase incorporates a fluorescently tagged nucleotide. Because these special bases do not ..., the reaction is halted once the fluorescently tagged base is incorporated. Sanger sequencing requires...because the ultimate goal is to have a fluorescently tagged nucleotide at each position in the DNA sequence...
  35. Even more elegant: Single injection CRISPR/Cas9 in C. elegans

    Type
    Blog Post
    ...hours worth of hands-on time. Creating a modular, selection-based gene tagging approach Multiple features...as the repair template plasmid to create fluorescent and 3xFLAG-tag fusion proteins. The repair template...added flanking loxP sites and a heat-shock inducible Cre to generate a self-excising cassette (SEC). To make... between a fluorescent protein (FP) and a 3xFLAG tag (see construct schematic below.) After self-excision...intron, and only the fluorescent protein and 3xFLAG-tag sequences are inserted into the genome. Figure.... (2015) illustrating the steps to fluorescently tag a C. elegans protein. The his-72 locus is shown as...little hands-on labor and could facilitate the tagging of every protein in the C. elegans genome. Although...
  36. Hot Plasmids: Fall 2024

    Type
    Blog Post
    ...Epitope tag antibody collection grows By Ashley Waldron We are excited to highlight the Anti-V5 tag antibody... as a tag since 1992 (Hanke et al., 1992), and has proven itself a versatile option for tagging proteins...immunodeficiency virus p27 using tag-specific monoclonal antibody and tag-linked antigen. J Gen Virol., ...Figure 3: Expression of fluorophore-tagged GOLG-4 through eight stages of embryonic development. Representative...find in this post: Anti-V5 and other new epitope tag antibodies from IPI New tool for structural studies...studies of E3 ligase cereblon Optimized mScarlet-based tags for live imaging in C. elegans CRISPR/Cas9 for gene...Innovation (IPI), part of a new collection of epitope tag antibodies available through Addgene. Anti-V5 [IPI-SV5...
  37. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...electron microscopy (EM) tag providing superior subcellular localization of tagged proteins compared to traditional...additionally incorporates SUMO tags in the FP sequence for separation from Cre-based Brainbow-expressing cells...contain a variety of N- and C-terminal tags (including His, S-tag, OneStrep, CBP, Trx, GST, Halo, MBP, ...promoter, N-terminal tag, coding sequence of the gene of interest, C-terminal tag, plant terminator, and...of an isopeptide bond between 2 peptide tags, SpyTag and KTag. The group demonstrated the use of the SpyLigase... short hairpin) and CRUSH (Conditional RUSH) use Cre-mediated recombination to turn on or off the expression...a dual-color RNAi “sensor” mouse strain in which Cre expression causes the induction of both DsRed fluorescence...
  38. Targeted Mutagenesis with EvolvR

    Type
    Blog Post
    ... a unique tag into a genomic site of choice via the mutational abilities of PolI3m. This tag would allow...modular nature, the Dueber Lab created a few versions of EvolvR. To increase the mutation rate of EvolvR,...with a targeted mutagenesis rate ~9-fold higher than the original nCas9, while increasing the standard mutation...mutations to PolI3M generated PolI5M which increased EvolvR’s mutagenesis rate to ~10-3 mutations per nucleotide...bacteriophage T7 DNA polymerase increased the processivity of PolI3M, and thereby increasing the editing window of...result in a spectinomycin resistant phenotype in bacteria. While there are many known spectinomycin resistance... for mutagenesis, a feature which they used to generate bacteria resistant to both spectinomycin and streptomycin...
  39. Plasmids 101: Knockout/Knock-In Plasmids

    Type
    Blog Post
    ...construct, the neomycin resistance gene is floxed so that it can be removed post-selection through Cre-mediated...want to create a conditional knockout. To make a conditional knockout, researchers often use the Cre/Lox ...researchers usually remove it after selection using the Cre/Lox recombination system. After “floxing” the resistance... you can remove the gene through the addition of Cre recombinase (Figure 2). Figure 2: A knockout...make it possible to insert, or knock-in, any gene, tag, or mutated exon into the genome. For this purpose...example, you can remove a floxed resistance gene using Cre recombinase. If GFP is under control of an endogenous...promoter responds. You can also use this method to tag an endogenous protein with GFP, as seen in blue flame...
  40. Visualizing Protein Turnover In Situ

    Type
    Blog Post
    ...protein tags can be used to facilitate the visualization of specific proteins in cells. Tagged protein...containing AHA to a fluorescent alkyne tag. The newly synthesized and tagged proteins can then be observed with...the knock-in of fluorescent tags into the gene locus of interest. An advantage of this alternative is the...here, there is the question of whether or not the tags influence behavior. A conference and a breakthrough... known as fluorescence noncanonical amino acid tagging (FUNCAT, Dieterich et al. Nature Neuroscience, ...protein of interest that also had incorporated the AHA tag after pulse labeling of a determined period of time...used for cell labeling Check out other protein tagging strategies Additional Resources on Addgene.org...
  41. Your Top Requested Plasmid in 2016!

    Type
    Blog Post
    ... SpCas9 is also fused to a 3X FLAG tag at its N-terminus. This tag can be used to test for SpCas9 expression...Alternative forms of this vector contain GFP-tagged and un-tagged versions of SpCas9 and further variants ...SpCas9 is fused to the puromycin resistance gene through a 2A peptide. The puromycin resistance gene enables...causes the ribosome to translate Cas9-2A and the Puromycin resistance gene as separate peptides. PX459 This...predecessor, which had a point mutation in the puromycin resistance gene that made it less effective in...SpCas9n (nickase), which nicks DNA rather than creating double stand breaks and may better facilitate ...
  42. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type
    Blog Post
    ...expression ~ ~ ~ ~ ✓   ✓ SV40 and c-Myc nuclear localization sequences Improve translocation..., the Liu lab created and evaluated 19 PE1 variants with RT mutations known to increase activity, enhance... initial nick site (to avoid creating a double strand break), increasing editing efficiencies 2-3-fold... Figure 1: An overview of prime editing. Created with BioRender.com. How does it work? First...ones in Addgene’s repository later in the post. Advantages of prime editing Less constrained by PAM sequence... between the template and primer binding site, increase processivity, or improve thermostability. What...fold. However, the process of double nicking increases indel formation slightly. Designing the sgRNA with...
  43. Tag Your Favorite Yeast Genes with Ease

    Type
    Blog Post
    ..., modular plasmids, combining fluorescent tags, epitope tags, protease sites, and selection markers. These...fluorophore tagging vectors for your single or multi-color imaging experiments. Interested in epitope tags? Others...have genome tagging systems enabled you to advance your research? Do you have a favorite tagging system that...Researchers have long taken advantage of this natural process to integrate protein tags into the genomes of S...multiple cloning site in place of the epitope tag for creation of your own unique protein fusions. This collection...promoter substitution), and tagging at either the N- or C-terminus (3xHA, 13xMyc, GST, or GFP). Longtine ...especially useful in protein complex studies where tagging of multiple protein products is desired, as multiple...
  44. Tagging Optogenetics and Chemogenetics Receptors: Fluorescent Proteins and Other Options

    Type
    Blog Post
    ...transgene expression. Which tag should I use? When deciding on the appropriate tag, the experimental design...our studies suggest that non-fluorescent tags may be advantageous over fluorescent proteins when the fluorescence... methods, these proteins are routinely fused to ‘tag’ or ‘label’ proteins to facilitate its detection....detection. Fluorescent proteins are most widely used tags because they emit endogenous fluorescence that allow...protein (GFP) and mCherry, two of the most common tags currently used, are approximately 240 amino acids...most of them were still cytoplasmic. Use of ‘small’ tags to identify proteins Given the limited expression...monkey neurons, we next hypothesized that a different tag fused to the hM4Di might improve the transport of...
  45. Control AAV Preps

    Type
    Collection
    ...Activity Cre-dependent Flp-dependent Cre and Flp-dependent Cre, Flp, and VCre-dependent Constitutive (non-cre-dependent...Fluorophore/Tag Green Red None Other Cre-dependent color switch Brainbow constructs Spaghetti monster tags Activity... not fluoresce) Cre dependent 1 Looger 45185 AAV-EF1a-BbTagBY EF1a TagBFP and EYFP Cre dependent 9 Sanes...(non-cre-dependent) Clear Filters ID Name Promoter Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-...EF1a EYFP Cre dependent 1, 2, 5, 9, rg* Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent...nls-EGFP Cre dependent 1, 2, 5, 8, 9, rg* Harvey 131002 pAAV-Ef1a-DIO mScarlet EF1a mScarlet Cre dependent... hSyn EGFP Cre dependent 1, 2, 5, 8, rg* Roth 50459 pAAV-hSyn-DIO-mCherry hSyn mCherry Cre dependent 1...
  46. Hot Plasmids and Viral Preps - March 2021

    Type
    Blog Post
    ... well as additional useful tags, including 3xFLAG epitopes, TEV and BioTag, which can be used in protein... protein effectivity), and a fluorescent protein tag for visualization (Fig. 1b). While the probes target...ultimately leading to the degradation of the AID-tagged protein. To quantify protein degradation the Ward...44 amino acids auxin inducible degron sequence) tagged proteins. Degradation of your protein interest ...Gibson and Saptrap cloning systems to generate AID* tagged CRISPR knock-in repair constructs. These repair...repair constructs can be used to integrate the tagged AID* into genomic sites of interests via CRISPR techniques...engineering plasmid tools in about a week. Taking advantage of Golden Gate cloning, the Haynes lab’s Protocols.io...
  47. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ... Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...Knockout Library 171531 Knockout Human Li 3rd ~6 9,274 MYC-CRISPR Library 173195 Knockout Human Dzikiewicz-Krawczyk...In a CRISPR screening experiment, target cells are treated with the pooled library to create a population...mutant cells that are then screened for a phenotype of interest. Screening experiments using a pooled ...1000000074 (Puromycin) Activation Human Zhang 3rd 3 70,290 SAM v1 - 3 plasmid system 1000000075 (Puromycin) Activation...CRISPR pooled libraries for large-scale functional screens. Available for knockout, activation, inhibition...Blog Posts CRISPR is a useful tool for genetic screening experiments, due to the relative ease of designing...
  48. Multiple Plasmids at a Low Price: Kits from Addgene

    Type
    Blog Post
    ...additionally contain various combinations of protein tags (His, Avi, and GFP) as well as protease sites to...researcher to quickly generate N- and C-terminal epitope tag fusions to a protein of interest. The plasmids used...folding and/or protease sites to remove the epitope tags. Different plasmids in the kit can be used to purify...2015). He has also constructed a library of eGFP-tagged human ORF clones to allow testing and comparison...conveniently performed through the N-terminal eGFP tag carried on all constructs. The Cell-Free Protein ...greatly reduced costs per plasmid. We generally create kits to allow you to easily use a set of plasmids...markers built into all plasmids in the kit help decrease false positives observed in the cloning process...
  49. Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

    Type
    Blog Post
    ...The permanent labelling of cells using cre-lox is advantageous when compared to photoactivable or photoconvertible...cells according to whether or not they have been tagged with a fluorescent protein or dye. It separates... distinguishing cell populations that have been tagged with different fluorescent proteins or dyes. 3....useful tool for marking and tracking cells is the the Cre/lox recombination system. A researcher can flank ...expression is turned on or off in cells expressing Cre. The result of a system like this is a mosaic of ...progenitor cell migrating to the epithelium). At this stage, only cells from the immune system show wide scale... In the past 15 years efforts have been made to create transgenic mice expressing fluorescent protein ...
  50. Tips for arabidopsis transformation

    Type
    Blog Post
    ...terminally tagged fusion proteins with fluorescent (YFP, GFP, CFP, RFP, etc.) or affinity tags (HA, FLAG... plant selection markers (basta, hygromycin, kananamycin, tunicamycin) (Nakagawa et al., 2007). Alternatively...new inflorescences begin to grow. This will also increase the number of inflorescences overall, which may...them again.  This won’t hurt them, and it will increase the chances of tDNA integration. Selecting Arabidopsis... seeds too densely during selection: this will increase background growth of non-transformants and make...Gateway Binary Vectors: High-Performance Vectors for Creation of Fusion Constructs in Transgenic Analysis of...
Showing: 1 - 50 of 101 results