We narrowed to 47 results for: YFP tag
-
TypeBlog Post...favorite protein (YFP). You have two options: Option #1: Affinity tag purification You tag YFP and use an affinity...binding YFP to the column, you wash several times to remove non-specific proteins, and then elute YFP. Option...Opto-Nanobodies (OptoNBs) purification You skip adding a tag to YFP and instead use OptoNBs. You fill a column with...the lights, OptoNBs bind YFP and non-specific proteins flow through. To elute YFP, you turn on the blue ...protein. OptoNBs were also tagged with an infrared fluorescent protein tag which let the team detect its... be tagged, which limits these approaches to use with recombinant proteins. Purifying an untagged protein...used nickel-coated agarose beads coated with his-tagged OptoNBs. OptoNB coated beads were then imaged while...
-
Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior
TypeBlog Post...GFP (green) to RFP, CFP, or YFP fluorescence. In Brainbow 2.1, GFP is tagged with a nuclear localization...Brainbow. Brainbow 1.0 used the fluorophores RFP (red), YFP (yellow), and membrane-tethered CFP (cyan). Brainbow...localize to a different area of the cell than CFP and YFP. The most recent derivation of Brainbow, Brainbow...incorporate a truncated, non-fluorescent form of YFP as the default state of the transgene such that recombination...recombination is necessary to excise the non-fluorescent YFP and activate fluorescence of the downstream OFP, ...can be detected by immunostaining of the truncated YFP. In Thy1-Brainbow mice, some neurons expressed as...called Zebrabow-GateDest containing an RFP, CFP, and YFP downstream of a ubiquitous promoter. Zebrabow is ... -
Hot Plasmids and Viral Preps - January 2021
TypeBlog Post...variants of Yellow Fluorescent Protein (YFP). The team identified a new YFP variant, mGold. mGold was found to... as bright to mVenus, the parent YFP, and is the most photostable YFP to date. As such, mGold is expected...screening, Single-cell Phenotypic Observation and Tagging with Light (SPOTlight) as a way to isolate individual... -
Tips for Using FRET in Your Experiments
TypeBlog Post...C-terminal His tag SYFP2 Yellow Mammalian Express a gene of interest fused to the C-terminus of SYFP2 Clover... mCerulean/Amber, mCerulean/SYFP2A, mTurquoise/mVenus and others. CFP-YFP is still one of the best and...significant overlap in their spectra. The pair CFP-YFP was the first to be used to study protein-protein...Bacterial Expresses Aquamarine with N-terminal His tag pAquaN1 Cyan Mammalian Expresses mammalian optimized...Cyan Bacterial Expresses CyPet with C-terminal His tag SCFP3A Cyan Mammalian Express a gene of interest...popular pair, CFP has five-fold less brightness than YFP. The stoichiometry of donor:acceptor is difficult... -
When is a Monomer not a Monomer? The Top Three Ways Your Favorite Fluorescent Protein Oligomerizes in Cells
TypeBlog Post...solution or something in between, you are using a tag with a serious drawback. The standard EGFP plasmid... of a POI. As an investigator, you want a fusion tag to be inert, to not produce artifacts in your experiments...Several early FRET biosensors were made with CFP and YFP, cyan and yellow variants of EGFP equally capable...capable of dimerizing as EGFP. As a result, CFP and YFP dimers can form in the absence of environmental changes...other GFP family members (superfolder, Emerald, CFP, YFP, BFP, Cerulean, Turquoise, Venus, and Citrine) can...oligomers such as DsRed or high affinity FPs such as TagRFP. Problem 3 can be solved, in most cases, by using... -
Choosing Your Fluorescent Proteins for Multi-Color Imaging
TypeBlog Post...is the ability to follow multiple fluorescently tagged species simultaneously. To do so with fluorescent...nm. For example, CFP (ex 430 nm / em 474 nm) and YFP (ex 514 nm / em 527 nm) can be imaged together but...multicolor imaging include ones designed for CFP, YFP, and RFP or the Sedat Quad filter set, designed for...generally the most detectable and so should be used to tag your least abundant proteins, with the blue and infrared...#49004) to the spectra of both mCherry and TagRFP. Here, the TagRFP spectrum is shown in the darker colors...peak of the TagRFP excitation and the emission filter collects a larger fraction of the TagRFP emission ...with this set are mTagBFP2, EGFP or one of the improved GFP variants, mRuby2 or TagRFP-T, and an infrared... -
Hot Plasmids: Winter 2025
TypeBlog Post...Twelvetrees Lab took advantage of the self-labeling tags SNAPf and CLIPf. These tags rely on synthetic dye...single- and double-tagged constructs (including "CLAP", combining an N-terminal CLIPf tag and a C-terminal...of Gα-GTP by BRET. The biosensor consists of a YFP-tagged G protein and a NanoLuc® (Nluc) Luciferase-fused...dicots Self-labeling tags for single-molecule biophysics Fast and responsive voltage indicator ONE-GO biosensors...2024.02.11.579803). CLIP, CLAP, SNAP! Self-labeling tags for single-molecule biophysics By Mike Lacy In order...C-terminal SNAPf tag; see Figure 2), the authors developed a cost-effective expression and labeling approach ... The team deposited an array of constructs for tagging the kinesins KIF5A and KIF5B as well as backbones... -
Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons
TypeBlog Post... contains three fluorescent proteins: RFP (red), YFP (yellow) and M-CFP (membrane tethered cyan). Without...expressed. Cre can mediate one of two deletions to allow YFP or M-CFP expression; these deletions are defined ...construct can express one of four colors (n-GFP, RFP, YFP or M-CFP.) The construct contains two tandem invertible...the promoter. The STOP cassette includes a mutant YFP that does not fluoresce, but can be detected via ... (AAV) available - AAV-EF1a-BbChT and AAV-EF1a-BbTagBY. These constructs contain two XFPs each due to ... -
The Developmental Studies Hybridoma Bank: Over 25 Years of Antibody Sharing
TypeBlog Post...against popular fluorescent proteins (GFP and YFP) and protein tags (c-MYC and HA). We have also created the... -
Hot Plasmids May 2018 - Optogenetics, Decaffeination, Biosensors, and Fluorescent Protein Tools
TypeBlog Post...encoding alternative promoters and/or fluorescent tags are available at Addgene. Shemesh OA, et. al. ...ShadowY, a novel dark yellow fluorescent protein (YFP) with an excitation peak of 519 nm. These proteins...microscopy) assays. ShadowG is darker than other dark YFP mutants, it reduces the risk of spectral contamination...change that placesTagRFP-T and Dronpa in close proximity. By monitoring changes in TagRFP-T fluorescence...FLINC)-based biosensors measure fluctuations of TagRFP-T fluorescence intensity due to interactions with...membrane in living cells using a construct in which TagRFP-T and Dronpa flanked a PKA substrate fused to the... -
The Michael Davidson Collection: One-Stop Shop for Fluorescent Proteins
TypeBlog Post...spectra. A comprehensive list of cell markers all tagged with mEmerald. Plasmids to monitor protein-protein... the standard oldies but goodies (e.g., EGFP and YFP) to the new and improved fruit colors (e.g., apple...available targets since the Davidson lab always tagged new proteins with mEmerald first, Baird says. From...cell membrane, this collection has fluorescently tagged versions of many proteins known to localize to ...Democrat in a story about his life’s work and the stage IV lung cancer that has now prompted him to deposit... -
Teaching an Old DOG New Tricks: Controlling Protein Activity with GFP
TypeBlog Post...specificity of their system, Tang et al. found that YFP and CFP can activate certain T-DDOG constructs similarly...GFP), is activated by GFP and derivatives GFP and YFP, but not red fluorescent proteins, as seen with T-DDOGs...optogenetics in specific cell populations even easier. Advantages and other possibilities It’s clear that Cre-DOG...GFP-labeled lines, and they each have their own advantages. T-DOGGs can be made drug-inducible using the... -
Hot Plasmids June 2018 - Reverse transcriptase, nanobody, and protein-DNA interaction tools
TypeBlog Post...can be used to target any protein fused with GFP, YFP, mCerulean, or other related fluorophores. Find all...labels proximal proteins with biotin as an affinity tag. This ‘Caspex’ construct is guided by a pre-defined...biotinylation at genomic elements by restricted spatial tagging), to confirm the composition of proteins found ...antibodies found in camelids. They possess many advantages over conventional antibodies: they are small ... -
Which Fluorescent Protein Should I Use?
TypeBlog Post...variants blue FP (BFP), cyan FP (CFP), and yellow FP (YFP) were derived. For a breakdown of GFP, it's variants...CFP) excites the fluorescence of another FP (e.g. YFP). FRET only occurs when the distance between the ...pHTomato (pH sensors), HyPer (H2O2 sensor), ArcLight (voltage sensor), and iGluSnFr (glutamate sensor). More ...can fold in <10min at 37°C, mCherry takes ~15min, TagRFP ~100min and DsRed ~10hours. Temperature: FPs maturation...is set as 1. Some proteins are very dim (e.g. TagRFP657, which has a brightness of 0.1) and this should... -
Bright Monomeric Fluorescent Proteins: mNeonGreen, mTFP1, and mWasabi
TypeBlog Post...times brighter than the most commonly used GFPs and YFPs. Its excitation maxima is at 506 nm and its emission...respectively. mNeonGreen can be used as a fusion tag for a wide range of applications from traditional...from the tetrameric yellow fluorescent protein (LanYFP) from the marine invertebrate Branchiostoma lanceolatum...Institute developed mNeonGreen via 21 substitutions to LanYFP and the addition of the enhanced GFP (EGFP)-type...was then screened through successive rounds of mutagenesis for the brightest teal fluorescent proteins that...scientists from Florida State University, they used a mutagenesis approach and found that specific amino acid changes... -
Fluorescent Tagging of Endogenous Genes with SapTrap
TypeBlog Post...T2A-TurboGFP-PEST), and small epitope tags (HA, Myc, Strep tag II, AviTag, HaloTag, SpyTag). The Foerstemann lab developed... scarless tag insertion. In addition to the obvious advantages SapTrap offers for tagging a single genetic...between the tag and homology arms). Digestion of the donor plasmids with SapI allows the tag, selectable... inserting a tag at multiple target sites. SapTrap vectors can be easily modified to tag hundreds of genes...insertion tagging), developed by the Hornung Lab, allows users to easily create C-terminal tag fusions ... toolkit offers C- and N-terminal tagging vectors (eg GFP, Flag, YFP, Strep, TEV-V5) with either blasticidin...endogenous protein tagging, please visit our website CRISPR/Cas Plasmids - Protein Tagging. Beyond simply... -
Photosensitizer Induced Cell Ablation with FAP-TAP MG-2I-dL5**
TypeBlog Post...development in real time. In both cases, dL5** was tagged with mCerulean3 (mCer3) for visualization and expressed...small amounts of non-specific ROS when exposed to YFP and RFP excitation wavelengths, which suggests that...xOtH5bs4HiI Advantages of MG-2I-dL5** over other photosensitizers One of the main advantages of MG-2I-dL5... -
Tips for arabidopsis transformation
TypeBlog Post...terminally tagged fusion proteins with fluorescent (YFP, GFP, CFP, RFP, etc.) or affinity tags (HA, FLAG... -
Neurodegeneration Plasmid Collection
TypeCollection...pRS416Gal TDP43 WT YFP TARDBP YFP GAL1 ALS Aaron Gitler 27448 pRS416 Gal G294A YFP TARDBP YFP GAL1 ALS Aaron...pRS416 Gal M337V YFP TARDBP YFP GAL1 ALS Aaron Gitler 27450 pRS416 Gal Q331K YFP TARDBP YFP GAL1 ALS Aaron...pRS303 Gal TDP-43 YFP TARDBP YFP GAL ALS Aaron Gitler 27470 pDONR TDP43 WT YFP TARDBP YFP ALS Aaron Gitler...Gitler 29592 426Gal-FUS-YFP FUS YFP GAL1 ALS Aaron Gitler 29593 416Gal-FUS-YFP FUS YFP GAL1 ALS Aaron Gitler...29594 416GPD-FUS-YFP FUS YFP GPD ALS Aaron Gitler 29595 416Gal-SV40NLS-FUS-YFP FUS YFP, SV40 NLS GAL1 ALS...426Gal-FUS-1-170aa-YFP FUS YFP GAL1 ALS Aaron Gitler 29597 426Gal-FUS-1-270aa-YFP FUS YFP GAL1 ALS Aaron ...426Gal-FUS-1-373aa-YFP FUS YFP GAL1 ALS Aaron Gitler 29599 426Gal-FUS-1-413aa-YFP FUS YFP GAL1 ALS Aaron ... -
Special Delivery: Fluorophore Targeting for FRET Studies
TypeBlog Post...C-terminal fusion of a tetracysteine tag. In addition, since these tags are so small, one can insert them... lure the ribosome into inserting a fluorophore-tagged amino acid at a stop codon (often amber i.e. UAG...termination at stop codons, expression levels of these tagged proteins are often very low. In addition, a major...which can be carried out using Addgene plasmids. His-tag labeling reagents You may already have a FRET acceptor-binding...: you just don’t know it yet! The poly-histidine tag often used for protein purification is a reliable...for protein purification: the NTA binds to the His tag on your protein and the coupled Cy fluorophore acts...well as by extending the length of the histidine tag from 6 to 10 residues. While these Cy/NTA conjugates... -
Viral Vectors 101: Calcium Sensors
TypeBlog Post...the available biosensors use a single GFP or CFP/YFP-derived FRET pair. If you need to free up crowded...using viral vectors! One of the most significant advantages of viral delivery is the potential for long-term...results in calcium assays. There’s another crucial advantage: tissue-specific targeting. By employing various... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection... NLS mCherry Connie Cepko 37341 pQC NLS YFP IX Nucleus NLS YFP Connie Cepko 158000 pCaggs-NLS-PAmCherry1...miRFP703 Vladislav Verkhusha 1816 Lamp1-YFP Lysosomes Lamp1 YFP Walther Mothes 1817 Lamp1-RFP Lysosomes...Bruchez 45944 pTDpelB-C_sfYFPTwinStrep Periplasmic space PelB signal sequence YFP Thorben Dammeyer 54520...Plasmids encoding fluorescent proteins tagged with genes or peptides with known subcellular localization...Voeltz 79802 pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc...Mothes 79806 pTag-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-...endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson... -
Plasmids 101: Multicistronic Vectors
TypeBlog Post...pMSCV-pBabeMCS-IRES-RFP IRES Retroviral pMSCV-IRES-YFP II IRES Retroviral pCMMP-MCS-IRES-Puro IRES Retroviral...expressed from the same cassette is sometimes advantageous, particularly when only a portion of the plasmid... mRNA. However, some bicistronic vectors take advantage of an element called an Internal Ribosome Entry...bicistronic vectors; however, they do have some disadvantages. These elements are quite large (500-600 bp)...vector.3 2A Peptides To overcome some of the disadvantages of the IRES element, scientists have adapted... -
CRISPR Plasmids - Tagging
TypeCollection...C-terminal tagging in Drosophila cells. N terminal tagging in Drosophila cells 3.2 MB C terminal tagging in Drosophila... CRISPR Protein Tagging CRISPR Plasmids - Protein Tagging Browse...allow tagging of proteins expressed from their natural chromosomal context. These CRISPR tagging methods...and throughput over traditional tagging methods. Several different tagging techniques, as well as the plasmids...design. How to use CRISPR to tag your gene of interest Mendenhall and Myers Tagging System The Eric Mendenhall...deposited plasmids in this CRISPR-Cas tagging system were tested by tagging transcription factors with FLAG ...Protocol 134.7 KB Mendenhall and Myers Tagging Plasmids Protein Species Tag Donor Plasmid gRNA plasmid gRNA ... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Includes tagging with CFP, YFP, and mRFP Tsoulfas Lab Lentiviral Plasmids - Fluorescently tag your gene...Maturation Structure Plasmids EYFP 513 527 51 6.9 Prone to dimerization pcDNA3-YFP - Mammalian Expression Topaz...Lab Vectors - Gateway cloning; includes tagging with ECFP, EYFP, DsRed, Cerulean Bacteria Gradia Lab Bacterial...empty plasmid backbones with different fluorescent tags for you to create fusion proteins with your gene... iRFP Gradia Lab Mammalian Plasmids - Includes tagging with mCherry, mCitrine, mCerulean Davidson Lab ...C. elegans Hamdoun Lab Plasmids - Set includes tagging with mCherry, Cerulean, Citrine, and eGFP pPD95... -
Split Fluorescent Proteins for Studying Protein-Protein Interactions
TypeBlog Post...experiment. Highlighted Split-Fluorescent Protein Tags Browse the table below, and click the Article link...cellular proteins with split fluorescent protein tags. Tamura R, Jiang F, Xie J, Kamiyama D. Commun Biol...most-requested GFP(1-10) and GFP(11) Versatile protein tagging in cells with split fluorescent protein. Kamiyama... monomeric near-infrared fluorescent proteins as tags and biosensors for multiscale imaging. Shcherbakova... Fluorescence-activating and absorption shifting tag (FAST) for use with green-yellow or orange-red fluorogen... -
Hot Plasmids - October 2022
TypeBlog Post...detecting protein tags. And when you think of protein tags, what are the first tags that come to mind...the Myc tag has become one of the most commonly used protein tags - a quick search for ‘Myc tag’ in the...guess that the Myc-tag is one of them (and not just because of the title!) The Myc-tag is a string of 10...Improved voltage indicator: JEDI-2P Novel class of light-gated potassium channelrhodopsins Myc-tag antibody...https://doi.org/10.1101/2021.09.17.460684.) Myc-tag antibody anti-c-Myc [9E10] now available! by: Ashley... 3: Image of Addgene’s western blot for the myc-tagged protein GFP-smFP-myc expressed from Plasmid 98926...imaging of voltages. This includes monitoring of fast bursts, as well as slow up/down voltage states in... -
Fluorescent Proteins 101: Green Fluorescent Protein (GFP)
TypeBlog Post...GFP for a wide number of functions, including: tagging genes for elucidating their expression or localization...technology is constantly being developed! Fusion tagging: One of the most common uses, GFP can be fused ...Purification: GFP can be used as a general epitope tag for protein purification and a number of commercial...Wildtype GFP EGFP F64L; S65T EYFP S65G; V68L; S72A; T203Y mYFP S65G; V68L; Q69K; S72A; T203Y; A206K...however, point mutations are acceptable. GFP's main advantage over conventional fluorescent dyes of the time...began engineering new versions of GFP through mutagenesis in order to improve its physical and biochemical...promoters of interest, to visualize the developmental stage at which these promoters are active. Further, GFP... -
Hot Plasmids - August 2020
TypeBlog Post...generated plasmids tagged with EB3 to mark the growing tips of microtubuli and plasmids tagged with MapTau to... the desired nanobody (NB) sequence, an AviTAG, and 6xHis tag. The MBP signal peptide allows the NB to...sequence-specific protease used to cleave affinity tags from purified recombinant proteins at small and ...cells were transfected with plasmids encoding FPs tagged with the plasma membrane targetin sequence derived...improved genetically encoded fluorescent markers tagged with mTurquoise2, mNeonGreen, and mScarlet-I for...commonly used for in vivo biotinylation via BirA and AviTAG. pMAK contains the signal peptide of MBP, followed...syn-FLEX-axon-jYCaMP1s. Find these AAVs at Addgene Cre-dependent EYFP AAV in the new serotype PHP.V1 that exhibits efficient... -
Fluorescent Protein Guide: Biosensors
TypeCollection...categories of biosensors or browse all the biosensors tagged in our catalog . Use the article links to find ... 2013 Nov 13;7:202. Colin Akerman Chloride (Cl-) YFP-derived sensor for measuring Cl- concentration in...in physiological range A genetically-encoded YFP sensor with enhanced chloride sensitivity, photostability...by a novel reporter protein, tandem fluorescent-tagged LC3. Autophagy. 2007;3(5):452-60. Tamotsu Yoshimori...Super-Ecliptic, pHluorin-mKate2, Tandem Fluorescent Protein-Tagged Human LC3 for the Monitoring of Mammalian Autophagy...Hoffman Voltage JEDI-2P voltage indicator for two-photon imaging Sustained deep-tissue voltage recording...Rafael Yuste Voltage Ultrafast fluorescent voltage sensor ASAP2f Subcellular Imaging of Voltage and Calcium... -
15 Hot Plasmids from 2017
TypeBlog Post...nonoverlapping emission spectra (N- and C-terminal tags for mTagBFP, TagRFPt, EGFP, mVenus, mCerulean3, mKOFP2) and...instance, inserting PhoCl in between a protein and a tag, such as an NLS or NES, enables control over localization...deposited with Addgene and include MYC- and FLAG-tagged TZAP constructs (wild-type and truncation mutants...gRNAs used for TZAP gene editing, and a Hi6xs-MBP tagged TZAPznf9-11constructs used for bacterial expression... demonstrate the power of mCyFP1, the Lin and Yasuda groups use both mCyFP1 and EGFP as FRET donors in...smooth endoplasmic reticulum (OSER) assay. A major advantage of mCyRFP1 is its ability to be coexcited along... used a combination of deliberate and random mutagenesis to isolate the best RFP. They targeted known ... -
Sequencing Primers
TypeGuide... TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer HAT GAGGAGCACGCTCATGCCCAC...Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT 3' end...primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end... -
Brain Armamentarium
TypeCollection...pAAV_BiSSTe4_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by SST interneuron-targeting...pAAV_BiPVe3_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by PV+ basket cell-targeting...pAAV_BiPVe4_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by chandelier cell-targeting...pAAV_BiLAMP5e3_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by Lamp5 interneuron-...pAAV_BiVIPe4_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by VIP interneuron-targeting...pAAV_BiCHATe27_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by cholinergic neuron-targeting...pAAV_BiSSTe10_ChR2_mCherry AAV construct expressing mCherry-tagged channelrhodopsin-2 driven by SST interneuron-targeting... -
Fluorescent Protein Guide: FRET
TypeCollection...C-terminal His tag SYFP2 Yellow Mammalian Express a gene of interest fused to the C-terminus of SYFP2 Clover ... suitable for creating individual fluorescently tagged proteins to study protein-protein interactions ...Bacterial Expresses Aquamarine with N-terminal His tag pAquaN1 Cyan Mammalian Expresses mammalian optimized...Cyan Bacterial Expresses CyPet with C-terminal His tag SCFP3A Cyan Mammalian Express a gene of interest ... EYFP connected by 8 GGSGGS repeats pET28CLY9 Peptide linker standard consisting of ECFP and EYFP connected...pET28CLY1 Peptide linker standard consisting of ECFP and EYFP connected by 1 flexible glycine- and serine-containing...pET28CLY2 Peptide linker standard consisting of ECFP and EYFP connected by 2 GGSGGS repeats pET28CLY3 Peptide ... -
Control AAV Preps
TypeCollection...Fluorophore/Tag Green Red None Other Cre-dependent color switch Brainbow constructs Spaghetti monster tags Activity...non-cre-dependent) Clear Filters ID Name Promoter Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive...Cre dependent 1 Looger 45185 AAV-EF1a-BbTagBY EF1a TagBFP and EYFP Cre dependent 9 Sanes 45186 AAV-EF1a-BbChT... EGFP Constitutive 5 Haydon 104055 pAAV-CAG-eYFP CAG EYFP Constitutive 2, 5, rg*, PHP.eB Gradinaru 104061...Constitutive 5 Khakh 105622 pAAV.CamKII(1.3).eYFP.WPRE.hGH CamKII(1.3) eYFP Constitutive 1 Deisseroth 105921 pAAV-CBh-mKate2... 1, 2, 5, 8, 9, rg* Deisseroth 117382 hSyn1-eYFP hSyn eYFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Gradinaru...Constitutive 1 Piatkevich 27056 pAAV-Ef1a-DIO EYFP EF1a EYFP Cre dependent 1, 2, 5, 9, rg* Deisseroth 28306... -
New Viral Vectors - Winter 2025
TypeBlog Post...Depositor Notes pAAV.CAGFLEX.(cyto).iATPSnFR2.S29W.A95K.HaloTag AAV5 Biosensor Tim Brown New viral prep ...Biosensor Marianne Fyhn New viral prep pAAV-Ef1a-fDIO EYFP AAV5. AAV8, AAVrg Control Karl Deisseroth New ...Wilson New serotype AiP12237 - pAAV-AiE0452h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2237) AAV-PHPeB Control Jonathan...viral prep AiP12787 - pAAV-AiE0140h_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2787) AAV-PHPeB Control Jonathan...New viral prep AiP12610 - pAAV-AiE0780m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2610) AAV-PHPeB Control Jonathan... AiP13755: pAAV-AiE0743m_3xC2-minBG-ChR2(H134R)-EYFP-WPRE3-BGHpA (Alias: CN3755) AAV-PHPeB Optogenetics...viral prep AiP14496: pAAV-AiE0873m_3xC2-minBG-SYFP2-P2A-3XFLAG-10aa-H2B-WPRE3-BGHpA (Alias: CN4496) ... -
AAV Molecular Tools
TypeCollection...pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a 5, rg* Heintz , Nectow , Schmidt...Expression of ER-localized TurboID (with HA and V5 tag). 8 Long 160857 pAAV-FLEx-ER-TurboID CMV-driven, ...expression of ER-localized TurboID (with HA and V5 tag). 8 Long Overexpression Tools These AAV encode various...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1 Gradinaru... Flp-dependent Flp-dependent expression of the voltage-gated Na+ channel mNaChBac and (physically separate... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...fusion protein. Read more about epitope tags and protein tags . Tag or Fusion Protein Common uses...collection page Return to top Epitope Tag or Fusion Protein Tags and fusion proteins are excellent tools...stop codon for C-terminal tags and omit the start codon for N-terminal tags. And when you are designing... C-terminal tagging in S. cerevisiae pCS2FLAG - N- or C-terminal 2xFLAG tag in pCS for ...Epitope tag pcDNA3.1-HA or c-Flag pcDNA3 - Mammalian expression vector with N- or C-terminal HA tag pInducer20...bacterial expression; His,GST tag pE2c - Modified pENTR vector for C-terminal 3x HA tag fusion with your gene ...gene of interest in plants Myc Epitope tag pKMyc - N-terminal Myc tag for mammalian expression pGEX-4T-1-... -
Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View
TypeBlog Post...Figure 1: Plasmid mix to label neuronal morphology (eYFP) and the synaptic protein PSD95 (PSD95-mcherry) ...expressing fluorescent cytoplasmic markers (e.g. eYFP) and synaptic proteins (e.g. postsynaptic PSD95-... Figure 2: Expression of a morphological marker (eYFP) and synaptic marker (PSD95-mcherry), under the ...Properties of FLP Recombinase Evolved by Cycling Mutagenesis.” Nature biotechnology 16(7): 657–62. PubMed ... -
Brain Initiative Collection
TypeCollection...Fluorescent reporter for serotonin (dendrite localization tag) Lin Tian 135420-AAV1 pAAV-syn-FLEX-jYCaMP1s Yellow...AAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for...AAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the Ef1a promoter. Used ...with pAAV-TREtight-mTagBFP2-B19G Ian Wickersham 100799-AAV1 pAAV-TREtight-mTagBFP2-B19G helper virus for...-CAG-DIO-EYFP An AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the...AAV2 pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ... -
Retrograde AAV viral preps
TypeCollection...105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn EGFP-tagged Cre expression Recombinases Wilson 105551 pENN....pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP-tagged Cre expression Recombinases Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH...pAAV-Ef1a-DIO EYFP EF1a EYFP, Cre-dependent Control Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP, Flp-dependent...Fon/Von eYFP nEF EYFP, Cre, Flp and VCre-dependent Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control...Cre-dependent Control Roth 55650 pAAV-hSyn Con/Fon EYFP Syn EYFP, Cre and Flp-dependent Control Deisseroth 28306...Dlx dTomato Control Fishell 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 112677 pOTTC1032 - pAAV EF1a... 3.0-EYFP EF1a Inhibitor, Cre-dependent Optogenetics Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn ... -
Optogenetics AAV Preps
TypeCollection...PHPeB Clear Filters ID Name Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV ...ET/TC)-EYFP nEF ChR2(E123T/T159C) EYFP Flp dependent 8 Deisseroth 26968 pAAV-Ef1a-DIO ChETA-EYFP EF1a ChETA...E123T/H134R)-eYFP.WPRE.hGH CaMKII ChETA EYFP Constitutive 9 Deisseroth 135633 pAAV-S5E2-C1V1-eYFP E2 C1V1 ...Arch3.3-EYFP nEF Arch3.3 EYFP Cre dependent 8 Deisseroth 137150 pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP nEF Arch3.3...Arch3.3 EYFP Flp dependent 8 Deisseroth 20949 pAAV-double floxed-eNpHR-EYFP-WPRE-pA EF1a eNpHR EYFP Cre dependent...pAAV-CaMKIIa-eNpHR 3.0-EYFP CaMKII eNpHR 3.0 EYFP Constitutive 1, 9 Deisseroth 26972 pAAV-hSyn-eNpHR 3.0-EYFP Syn eNpHR...eNpHR 3.0 EYFP Constitutive 2, 5 Deisseroth 137151 pAAV-nEF-NpHR3.3-EYFP nEF NpHR 3.3 EYFP Constitutive... -
New Viral Vectors - Spring 2025
TypeBlog Post... the research community. Customers have taken advantage of the customizability, choosing the cargo, serotype...Yizhar New viral tool pAAV-Ef1a-fDIO hChR2(H134R)-EYFP AAVrg Optogenetics Karl Deisseroth New viral tool... -
New and Upcoming Viral Vectors - May 2020
TypeBlog Post...Serotype Name Depositor 27056 AAVrg pAAV-Ef1a-DIO EYFP Karl Deisseroth 11447 AAV5 pAAV-Ef1a-fDIO mCherry...tools for light mediated neuronal control. The advantages of optogenetics lie in the spatiotemporal control...recombination of lox sites. This system takes advantage of the extensive supply of transgenic reporter... -
Caltech Systemic Capsids
TypeCollection...rAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA minBetaGlobin SYFP2 Control Ting 163509 CN1839-rAAV-hSyn1-SYFP2-10aa-H2B-WPRE3...Dlx mRuby2 Control Gradinaru 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP...EF1a mCherry Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control Gradinaru 135630 pAAV-S5E2-dTom-nlsdTom...-BGHpA hSyn1 H2B-SYFP2 Control Ting 191706 AiP13044 - pAAV-AiE0779m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias...: CN3044) minBG SYFP2 Control AIBS , Ting 191707 AiP12237 - pAAV-AiE0452h-minBG-SYFP2-WPRE3-BGHpA (Alias... - pAAV-AiE0743m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3038) minBG SYFP2 Control AIBS , Ting 191726 AiP12787... - pAAV-AiE0140h_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2787) minBG SYFP2 Control AIBS , Ting 191728 AiP12408... -
Penn Vector Core Partnership with Addgene
TypeCollection...H134R)-eYFP.WPRE.hGH Optogenetics Karl Deisseroth AV-1-26968P 26968-AAV1 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-1-26971P 26971-AAV1 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics...eNpHR 3.0-EYFP Optogenetics Karl Deisseroth AV-5-26968P 26968-AAV5 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-5-26972P 26972-AAV5 pAAV-hSyn-eNpHR 3.0-EYFP Optogenetics...floxed-eNpHR-EYFP-WPRE-pA Optogenetics Karl Deisseroth AV-9-26966P 26966-AAV9 pAAV-Ef1a-DIO eNpHR 3.0-EYFP Optogenetics...H134R)-eYFP.WPRE.hGH Optogenetics Karl Deisseroth AV-9-26968P 26968-AAV9 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-9-26971P 26971-AAV9 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics... -
Trimmer Lab NeuroMab Collection
TypeCollection.../9R] ZIP3 Mouse Mouse IgG2a 206600 Anti-S-tag [N56/9R] S-tag Bovine Mouse IgG2a 206601 Anti-TrpC4 [N77... Human Mouse IgG2a 114476 Anti-Synaptotagmin-3 [N278/19R] Synaptotagmin-3 Mouse Mouse IgG2a 114477 Anti-TRPML3... Human Mouse IgG2a 114482 Anti-Synaptotagmin-12 [N277/7R] Synaptotagmin-12 Mouse Mouse IgG2a 114483 Anti-GluA1...) Rat Mouse IgG2a 114558 Anti-Synaptotagmin-10 [N269/73R] Synaptotagmin-10 Mouse Mouse IgG2a 114559 Anti-Ataxin... Mouse Mouse IgG2a 177526 Anti-Synaptotagmin-7 [N275/14R] Synaptotagmin-7 Mouse Mouse IgG2a 177527 Anti-Lgi1... Human Mouse IgG2a 188216 Anti-Synaptotagmin-6 [N270/47R] Synaptotagmin-6 Mouse Mouse IgG2a 188217 Anti-CASK...Shank3 Rat Mouse IgG2a 188223 Anti-Synaptotagmin-9 [N276A/15R] Synaptotagmin-9 Mouse Mouse IgG2a 188224 Anti-TrpV1...