Skip to main content

We narrowed to 28 results for: EFS

Showing: 1 - 20 of 28 results
  1. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ... pCDH-EF1-DIO-copGFP 72253 Expresses copGFP under EF-1 promoter when Cre is expressed by another vector...pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed by another vector...vector pCDH-EF1-FLPe 72262 Expresses FLPe from the EF-1 promoter pCDH-EF1-copGFP-T2A-Puro 72263 Express... pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest...pCDH-EF1s 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2-P2A-copGFP 72485 Expresses...
  2. Lentivirus Plasmids

    Type
    Collection
    ...cDNA expression. David Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA under the control of a tet-responsive...cloned into the plasmid. Garry Nolan 12257 pWPXL 2nd EF-1alpha-driven constitutive transgene expression. ...gives high expression. Didier Trono 12254 pWPI 2nd EF-1alpha driven constitutive transgene expression and...EGFP coexpression. Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...additional variants. Stephen Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-...
  3. Plasmids 101: Codon usage bias

    Type
    Blog Post
    ... PubMed Central PMCID: PMC3565066. 7. Quax, Tessa EF, et al. "Codon bias as a means to fine-tune gene ...
  4. AAV Molecular Tools

    Type
    Collection
    ...Expression of SpCas9. 8 Hetian Lei 104588 pAAV-EFS-SpCas9 EFS-driven, constitutive Expression of Myc-tagged...
  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1 HTT GFP U6, EFS Huntington's Nicole Deglon 190903 pAAV2ss-EFS-GFP-synPolyA-U6...mRuby2 EF-1 alpha Friedreich ataxia Kate Galloway 235303 pLentiX1-[TRE3G-FXN-P2A-mRuby2-bGH]-EFS-rtTA-P2A-mGL-WPRE...LRRK2 His, V5 EF-1 alpha Parkinson's Mark Cookson 25081 pDEST51-LRRK2-R1441C LRRK2 His, V5 EF-1 alpha Parkinson's...LRRK2 His, V5 EF-1 alpha Parkinson's Mark Cookson 25083 pDEST51-LRRK2-R1441H LRRK2 His, V5 EF-1 alpha Parkinson's...LRRK2 His, V5 EF-1 alpha Parkinson's Mark Cookson 29398 pDEST51-LRRK2-R1398Q LRRK2 His, V5 EF-1 alpha Parkinson's...LRRK2 His, V5 EF-1 alpha Parkinson's Mark Cookson 29400 pDEST51-LRRK2-T1343G LRRK2 His, V5 EF-1 alpha Parkinson's...pLEX_307-SOD1WT SOD1 EF-1 alpha ALS Mohan Babu 83445 pLEX_307-SOD1E133delta SOD1 EF-1 alpha ALS Mohan Babu...
  6. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...pCAT112TAG-SepT) Plasmid 34623 SepOTSα SepRS/EF-Sep ( aka. pKD-SepRS-EFSep) References & Protocols Iterative Synthetically...phosphoserine to tRNA^Sep with anticodon, CUA. Engineered EF-Tu binds the phosphoserine-charged tRNA (AUC) and...
  7. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...Christopher Vakoc 138152 pLentiEGFPdestablized - EFS-EGFPd2PEST-2A-MCS-Hygro Lentiviral vector expressing...
  8. Lentiviral Prep Service

    Type
    Collection
    ...pyogenes Cas9 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. Zhang Cas9 and Accessories...
  9. Sequencing Primers

    Type
    Guide
    ...CTCTGAATACTTTCAACAAGTTAC Drosophila heat shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC Human elongation...
  10. New Optogenetic Tools for Cytoskeleton and Membrane Control

    Type
    Blog Post
    ...useful for a wide variety of experiments. Opto-RhoGEFs manipulate cell morphology and adhesion But what...pathways. Rho guanine-nucleotide exchange factors (GEFs) activate their partner Rho GTPase, leading to behaviors...Lab devised a set of optogenetic switches for the GEFs ITSN1, TIAM1, or p63RhoGEF (which activate the Rho...iLID system (Mahlandt et al., 2023). These Opto-RhoGEFs provide a reversible and non-invasive way to activate...be ready for the spotlight.    Figure 2: Opto-RhoGEFs to control Rho GTPase activity. A) Schematic of...4.0 license.   Mahlandt et al. used these Opto-RhoGEFs to study cell junction integrity in the vascular..., van Buul, J. D., & Goedhart, J. (2023). Opto-RhoGEFs, an optimized optogenetic toolbox to reversibly...
  11. Genetic Code Expansion

    Type
    Collection
    ...Bacterial TAG Wenshe Liu 173897 SepRS(2)/pSertRNA(B4)/EF-Sep aminoacyl-tRNA synthetase M. maripaludis phosphoserine...
  12. Summer SciComm Series: A PhD in Science Communication

    Type
    Blog Post
    ...information if those sources affirm or challenge their beliefs. I asked participants to read short abstracts ... to the abstracts that affirmed their personal beliefs even though all three texts were otherwise identical...for a study with findings that challenged their beliefs, they were much more likely to rate that study ...science literacy and education have more polarized beliefs on controversial science topics. Proceedings of...
  13. Single-cell tracking of lineage and identity with CellTag

    Type
    Blog Post
    ...direct reprogramming of mouse embryonic fibroblasts (MEFs) into induced endoderm progenitors (iEPs), a self-renewing...differentiate into hepatic or intestinal cell types. MEFs were reprogrammed into iEPs by retroviral expression...CellTagging to uncover two distinct trajectories of MEFs undergoing iEP conversion, but CellTag could be ...
  14. An Introduction to Adenovirus

    Type
    Blog Post
    ...genes that apparently contribute to virulence (Tollefson et al., 1996) – cell death has been reported when...10.1182/BLOOD-2007-02-062117. PMID: 17510320. Tollefson, A. E., Scaria, A., Hermiston, T. W., Ryerse, ...
Showing: 1 - 20 of 28 results