We narrowed to 30 results for: EFS
-
TypeCollection... pCDH-EF1-DIO-copGFP 72253 Expresses copGFP under EF-1 promoter when Cre is expressed by another vector...pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed by another vector...vector pCDH-EF1-FLPe 72262 Expresses FLPe from the EF-1 promoter pCDH-EF1-copGFP-T2A-Puro 72263 Express... pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest...pCDH-EF1s 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2-P2A-copGFP 72485 Expresses...
-
Lentivirus Plasmids
TypeCollection...used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA under the control of a tet-responsive...be cloned into the plasmid. Nolan 12257 pWPXL 2nd EF-1alpha driven constitutive transgene expression, ...that gives you high expression. Trono 12254 pWPI 2nd EF-1alpha driven constitutive transgene expression and...and EGFP coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...more similar plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-... -
15 Years of Addgene: The Top 15 Plasmids
TypeBlog Post...the U6 promoter and puromycin resistance from the EF-1a promoter. It’s a 3rd generation lentiviral backbone... -
New Tools Enable CRISPRa for Neuroscience Applications
TypeBlog Post...other promoters, including ubiquitous ones such as EF-1α and CAG. Figure 2: Dual lentivirus system... -
Plasmids 101: Codon usage bias
TypeBlog Post... PubMed Central PMCID: PMC3565066. 7. Quax, Tessa EF, et al. "Codon bias as a means to fine-tune gene ... -
Using Phosphoserine to Study Protein Phosphorylation
TypeBlog Post...encode phosphoserine, the Sep-tRNA synthetase, and EF-Sep – an optimized elongation factor that accepts... -
Neurodegeneration Plasmid Collection
TypeCollection...pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1 HTT GFP U6, EFS Huntington's Nicole Deglon 190903 pAAV2ss-EFS-GFP-synPolyA-U6...LRRK2 His, V5 EF-1 alpha Parkinson's Mark Cookson 25081 pDEST51-LRRK2-R1441C LRRK2 His, V5 EF-1 alpha Parkinson's...LRRK2 His, V5 EF-1 alpha Parkinson's Mark Cookson 25083 pDEST51-LRRK2-R1441H LRRK2 His, V5 EF-1 alpha Parkinson's...LRRK2 His, V5 EF-1 alpha Parkinson's Mark Cookson 29398 pDEST51-LRRK2-R1398Q LRRK2 His, V5 EF-1 alpha Parkinson's...LRRK2 His, V5 EF-1 alpha Parkinson's Mark Cookson 29400 pDEST51-LRRK2-T1343G LRRK2 His, V5 EF-1 alpha Parkinson's...pLEX_307-SOD1WT SOD1 EF-1 alpha ALS Mohan Babu 83445 pLEX_307-SOD1E133delta SOD1 EF-1 alpha ALS Mohan Babu...307-SOD1E133insTT SOD1 EF-1 alpha ALS Mohan Babu 83447 pLEX_307-SOD1E133K SOD1 EF-1 alpha ALS Mohan Babu... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection... and firefly luciferase. pLentiEGFPdestablized - EFS-EGFPd2PEST-2A-MCS-Hygro - Lentiviral vector expressing... -
Lentiviral Prep Service
TypeCollection...pyogenes Cas9 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. Zhang Cas9 and Accessories... -
Sequencing Primers
TypeGuide...Invitrogen) Drosophila heat shock promoter, forward primer EF-1a Forward TCAAGCCTCAGACAGTGGTTC (Invitrogen) Human... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...68307 SupD Plasmid 34623 SepOTSα SepRS/EF-Sep ( aka. pKD-SepRS-EFSep) Plasmid 34624 SepOTSα tRNA-Sep ( aka... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TGCAGCCGTGTTTCTACCcggacgaggatgacttCTACTTCTGCAGACCAGA NADPH oxidase, EF-hand calcium binding domain 5 TAL3496 & TAL3497 TGCCGCCAACTGGCTGAAacctccagatctggagCAGAACAAGCGCAAAA... -
CRISPR Pooled gRNA Libraries
TypeCollection... Suppressor Gene CRISPR Knockout Library 113584 (EFS) 113585 (TBG) Knockout Mouse Chen N/A (AAV) 4 286... -
Genetic Code Expansion
TypeCollection...Bacterial TAG Wenshe Liu 173897 SepRS(2)/pSertRNA(B4)/EF-Sep aminoacyl-tRNA synthetase M. maripaludis phosphoserine... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Lentiviral BsmBI none S. pyogenes Puro Maehr pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP 62348 Mammalian/Lentiviral BbsI...pLKO5.sgRNA.EFS.PAC 57825 Mammalian/Lentiviral BsmBI none S. pyogenes Puro Ebert pL-CRISPR.EFS.PAC 57828.../Lentiviral BsmBI none S. pyogenes Zhang pL-CRISPR.EFS.GFP 57818 Mammalian/Lentiviral BsmBI yes, cut S...Lentiviral BfuAI none S. pyogenes Puro Wolfe pL-CRISPR.EFS.tRFP 57819 Mammalian/Lentiviral BsmBI yes, cut S...Lentiviral none S. pyogenes Cerulean Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes...none S. pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR 60226 Mammalian/AAV SapI... SapI none S. pyogenes Zhang pLKO5.sgRNA.EFS.GFP 57822 Mammalian/Lentiviral BsmBI none S. pyogenes EGFP... -
New Optogenetic Tools for Cytoskeleton and Membrane Control
TypeBlog Post...useful for a wide variety of experiments. Opto-RhoGEFs manipulate cell morphology and adhesion But what...pathways. Rho guanine-nucleotide exchange factors (GEFs) activate their partner Rho GTPase, leading to behaviors...Lab devised a set of optogenetic switches for the GEFs ITSN1, TIAM1, or p63RhoGEF (which activate the Rho...iLID system (Mahlandt et al., 2023). These Opto-RhoGEFs provide a reversible and non-invasive way to activate...be ready for the spotlight. Figure 2: Opto-RhoGEFs to control Rho GTPase activity. A) Schematic of...4.0 license. Mahlandt et al. used these Opto-RhoGEFs to study cell junction integrity in the vascular..., van Buul, J. D., & Goedhart, J. (2023). Opto-RhoGEFs, an optimized optogenetic toolbox to reversibly... -
Summer SciComm Series: A PhD in Science Communication
TypeBlog Post...information if those sources affirm or challenge their beliefs. I asked participants to read short abstracts ... to the abstracts that affirmed their personal beliefs even though all three texts were otherwise identical...for a study with findings that challenged their beliefs, they were much more likely to rate that study ...science literacy and education have more polarized beliefs on controversial science topics. Proceedings of... -
Single-cell tracking of lineage and identity with CellTag
TypeBlog Post...direct reprogramming of mouse embryonic fibroblasts (MEFs) into induced endoderm progenitors (iEPs), a self-renewing...differentiate into hepatic or intestinal cell types. MEFs were reprogrammed into iEPs by retroviral expression...CellTagging to uncover two distinct trajectories of MEFs undergoing iEP conversion, but CellTag could be ... -
An Introduction to Adenovirus
TypeBlog Post...genes that apparently contribute to virulence (Tollefson et al., 1996) – cell death has been reported when...10.1182/BLOOD-2007-02-062117. PMID: 17510320. Tollefson, A. E., Scaria, A., Hermiston, T. W., Ryerse, ... -
CasPEDIA: A Functional Classification of Cas Enzymes
TypeBlog Post...you simply type in identifier keywords (Cas name, RefSeq ID, etc.) and you will see a table of protein entry...