Skip to main content

We narrowed to 21 results for: PA-GFP

Showing: 1 - 20 of 21 results
  1. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

    Type
    Blog Post
    ...irreversible PA-FP reported was PA-GFP. PA-GFP was derived from Jellyfish (Aequorea victoria) GFP (wtGFP) by mutating...mutation in PA-GFP generates a chromophore population that is more neutral, causing PA-GFP to display ...imaging models perfer the PA-RFPs over PA-GFP. Another class of irreversible PA-FPs are the photoconvertible...blue light (1). Similar to PA-GFP, scientists later developed red fluorescent PA-FPs by performing several...example, by engineering PA-GFP tagged to a mitochondrial matrix protein (mito-PAGFP) the Youle Lab was able...from the neutral to the anionic form, which allows PA-GFP to exhibit up to a 100-fold increase in fluorescence...Fluorescence) Brightness Excitation/ Emission (nm) PA-GFP Monomer UV-Violet Dark/ Green ~200 Medium 504/ ...
  2. New Optogenetic Tools for Cytoskeleton and Membrane Control

    Type
    Blog Post
    ...magenta) and PA probe GFP-PASS (green). After 30 minutes of blue light illumination, substantial PA accumulates...activity can be monitored by phosphatidic acid probe GFP-PASS. B) Time series of HEK 293T cells expressing...predominant membrane lipid, to phosphatidic acid (PA) or it can swap phosphatidylchonine’s choline head...    Figure 4: SuperPLD hydrolyzes membrane PC to PA. A) OptoPLD is recruited to plasma membrane or lysosomes...accumulates in the plasma membranes, indicated by the PA probe colocalizing with SuperPLDx30. Scale bar 10 ...
  3. Split Fluorescent Proteins for Studying Protein-Protein Interactions

    Type
    Blog Post
    ...Chang-Deng Hu Green sfGFP Split super-folder GFP, our most-requested GFP(1–10) and GFP(11) Versatile protein...Commun. 2016 Bo Huang spGFP Split superpositive GFP Split-superpositive GFP reassembly is a fast, efficient...base FP (for example, EBFP2(1–10) can be used with GFP(11)). Some of the articles linked below only provide... EBFP2 EBFP2(1–10) and Capri(1–10) for use with GFP(11) Multiplexed labeling of cellular proteins with...Kamiyama Cerulean Cerulean(1–10) for use with GFP(11) Multiplexed labeling of cellular proteins with...background signal (especially for some older split-GFP constructs or certain cell environments). Also consider...Huang Near-Infrared iRFP iSplit, comprised of PAS and GAF domains of iRFP713. Requires presence of ...
  4. Which Fluorescent Protein Should I Use?

    Type
    Blog Post
    ... of GFP, it's variants, and their relevant mutations, check out Marcy's post from last week on GFP. Additionally... are PA-GFP, Dendra2, and the mEOS proteins. Some proteins are reversibly switchable (e.g. rsEGFP, Dreiklang... a few hours. For example, superfolder GFP (sfGFP) and mNeonGFP can fold in <10min at 37°C, mCherry takes...affected by the temperature. For instance, enhanced GFP (EGFP) was optimized for 37°C, and is therefore most... the discovery of the Green Fluorescent Protein (GFP), a protein from the jellyfish Aequorea Victoria....below (or emission wavelenght range).  By mutating GFP, the variants blue FP (BFP), cyan FP (CFP), and yellow...be found at Addgene. Split FPs – some FPs (e.g. GFP, Venus) can be split into two halves, which are non-fluorescent...
  5. Lighting Up Cell Signaling with Photoswitchable Kinases

    Type
    Blog Post
    ...Expression with Cre-lox Control Protein Activity with GFP Resources at Addgene.org Find KTR reporter plasmids...photoswitchable Dronpa (dron= a ninja term for vanishing, and pa= photoactivation) domains on either side of the active...
  6. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... AAV-FLEX-Arch-GFP Optogenetics Ed Boyden AV-1-PV2527 99039-AAV1 pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics...pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics Ed Boyden AV-5-PV3446 59170-AAV5 pAAV-Syn-Chronos-GFP Optogenetics...pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics Ed Boyden AV-8-PV3638 65014-AAV8 pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics... AAV-FLEX-Arch-GFP Optogenetics Ed Boyden AV-9-PV2527 99039-AAV9 pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics...29777-AAV5 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV2509 29777-AAV9 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV3446 59170...59170-AAV9 pAAV-Syn-Chronos-GFP Ed Boyden AV-1-PV3511 98926-AAV1 pAAV.CAG.GFPsm-myc.WPRE.SV40 Loren Looger...Ed Boyden AV-1-PV3446 59170-AAV1 pAAV-Syn-Chronos-GFP Optogenetics Ed Boyden AV-1-PV3447 59171-AAV1 pAAV-Syn-ChrimsonR-tdT...
  7. Hot Plasmids Spring 2024

    Type
    Blog Post
    ...Figure 5: A) Representative confocal images showing GFP expression from ssAAV5s with hIBA1 or hIBA1a promoters...Quantifications showing high microglia specificity of GFP expression for the indicated ssAAV5s. C) Quantifications...SDS, splice donor site; SAS, splice acceptor site; pA, polyadenylation signal. Image reused from Riedmayr...
  8. Overcoming the AAV Size Limitation for CRISPR Delivery

    Type
    Blog Post
    ...markers were not increased compared to a control AAV-GFP. Not only did the AAV-SaCas9-sgRNA constructs mediate... B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang F (2015) In vivo genome editing using Staphylococcus...
  9. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Plasmids PA-sfGFP 485 511 400 Prone to dimerization PA-sfGFP-N1 - Mammalian Expression PA-sfGFP-C1 - Mammalian... Expression PA-GFP 504 517 400 14 Monomer (A206K) pPAGFP-N1 - Mammalian Expression pPAGFP-C1 - Mammalian... pRSETA-PAGFP - Bacterial Expression pFA6a-PA-GFP-kanMX6 - Yeast Expression pFA6a-link-yEPAGFP-CaUra3 ...Mammalian Expression sfGFP (superfolder GFP) 485 507 54 14 min Prone to dimerization sfGFP-N1 - Mammalian Expression...Expression EGFP 488 507 34 6 25 min Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian...Brightness pKa Maturation Structure Plasmids Free Use GFP (fuGFP) 395 503 Monomer pUS252 - Mammalian Expression...high concentration. Proteins that are derived from GFP and contain the A206K mutation are monomeric at all...
  10. Biosensor AAV Preps

    Type
    Collection
    ...pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 CAG Archon1 EGFP Cre dependent 5 Edward Boyden 115892 pAAV-Syn-Archon1-KGC-GFP-ER2 Syn...Syn Archon1 EGFP Constitutive 8 Edward Boyden 115893 pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] Syn Archon1...GCaMP6f 50943 pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6f-WPRE-pA Syn GCaMP6f mRuby2 Constitutive 1 Tobias Bonhoeffer...Khakh 68719 pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6f-WPRE-pA CAG GCaMP6f mRuby2 Cre dependent 1 Tobias Bonhoeffer...GCaMP6s 50942 pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA Syn GCaMP6s mRuby2 Constitutive 1 Tobias Bonhoeffer...Ting 68717 pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA CAG GCaMP6s mRuby2 Cre dependent 1 Tobias Bonhoeffer...68720 pAAV-hSyn1-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA Syn GCaMP6s mRuby2 Cre dependent 1 Tobias Bonhoeffer...
  11. Sequencing Primers

    Type
    Guide
    ...activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP Forward GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...CCATCTAATTCAACAAGAATTGGGACAAC 5' end of GFP Reverse GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW...TTTGCCCCCTCCATATAACA Rabbit beta-globin intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region...GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...5' end of tetracycline resistance gene Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA Reverse...early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N CGTCGCCGTCCAGCTCGACCAG...factor-1α promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N CGTCGCCGTCCAGCTCGACCAG...
  12. Zhang Lab CRISPR Page

    Type
    Collection
    ...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion ...PX552; U6 promoter-driven; for sgRNA cloning; has GFP-KASH for FACS sorting SaCas9 + single guide RNA: ... B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang F. Nature . 2015 Apr 9;520(7546):186-91. doi...9, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016... recombinase-2A-EGFP-KASH 60231 : sgRNA cloning backbone with Cre recombinase-2A-EGFP-KASH Detailed backbone...recombinase-2A-EGFP-KASH and an sgRNA. #60231 - AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR...
  13. Optogenetics AAV Preps

    Type
    Collection
    ...pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Jaws GFP Constitutive 5, 8, rg* Edward Boyden 84445 pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2...Karl Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn ChR2/H134R GFP Constitutive 8, rg* Edward Boyden 100054...Gradinaru 107708 pAAV-hSynapsin- soCoChR-GFP Syn CoChR (soma-targeted) GFP Constitutive 9 Edward Boyden 107712...107712 pAAV-hSynapsin-FLEX-soCoChR-GFP Syn CoChR (soma-targeted) GFP Cre dependent 9 Edward Boyden 35505 ...Deisseroth 122063 pAAV-EF1α1.1-ChrimsonR-GFP EF1a ChrimsonR GFP Constitutive 2 Edward Boyden 124650 pAAV-CamKIIa-C1V1...Christopher Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Edward Boyden 59171...Constitutive 8 Karl Deisseroth 22222 AAV-FLEX-Arch-GFP CAG Arch GFP Cre dependent 1, 9 Edward Boyden 28305 pAAV-FLEX-ArchT-tdTomato...
  14. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...both the GFP and the RFP proteins in the nucleus. During the first round of translation, the GFP proteins...Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment GFP-Rab4B Mitochondria mito-BFP...GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A GFP-Rab7A     ...protein Knock-off, is made up of three components: a GFP protein that binds to the coding region of a reporter...reporter mRNA via a PP7 coat protein (NLS-PCP-GFP) a RFP protein that binds to the 3’ UTR of the reporter...these dCas9s with one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize...monoclonal antibodies against them, fused them to GFP, and compared them to popularly used epitopes tags...
  15. Bacterial Expression Systems

    Type
    Collection
    ...pMRBAD-link-CGFP GFP (reconstructed) BiFC Lynne Regan 168257 168472 pMRBad-C-wtBlc pET11a-N-DiB2 DiB2 (reconstructed...Fluorescence (GFP+) Gram-negative bacteria Philip Poole 14460 pOT2 Promoter activity Fluorescence (GFPuv) Gram-negative... Guide to Selecting Fluorescent Dyes and Ligands GFP Fusion Proteins — Making the Right Connection Photoactivatable... pWA PAS-E BAD K-GAFm iRFP (reconstructed) BiFC Vladislav Verkhusha 52732 52733 pET11a-link-NGFP pMRBAD-link-CGFP...pRsetB-his7-Perceval ATP:ADP ratio Fluorescence (GFP) Escherichia coli Gary Yellen 187836 pVoPo-01 Promoter...bacteria Philip Poole 14083 pAKgfplux1 Promoter activity Fluorescence (GFPmut3a) and luminescence (lux operon...bacteria Attila Karsi 14076 pAKgfp1 Promoter activity Fluorescence (GFPmut3a) Gram-negative bacteria Attila...
  16. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...
  17. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ..., Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They...with unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many ... of DsRed connected to a pH-sensitive variant of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The...74302 pDestTol2CG2-Neurog1-Magneto2.0-p2A-mCherry-pA Zebrafish Expression   Human kinase domain constructs...
  18. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...199419 Anti-GFP [N86/38R-2b] GFP Aequorea victoria Mouse IgG2b 199420 Anti-GFP [N86/8R-2b] GFP Aequorea ...206719 Anti-GFP [N86/38R-1] GFP Aequorea victoria Mouse IgG2a 206720 Anti-GFP [N86/8R-1] GFP Aequorea victoria...Rat Mouse 206743 GFP scFv [N86/44] N86/44 scFv GFP Aequorea victoria Mouse 206744 GFP scFv [N86/20] N86...short and long Rat Mouse IgG2a 114492 Anti-GFP [N86/38.1R] GFP Aequorea victoria Mouse IgG2a 114493 Anti-NGL...glutamate receptor Rat Mouse IgG2a 177572 Anti-GFP [N86/8R] GFP Aequorea victoria Mouse IgG2a 177573 Anti-...N479/107R] VAPA/B Mouse IgG2a 188164 Anti-GFP [N86/44R] GFP Aequorea victoria Mouse IgG2a 188165 Anti-.../22R] Prrt2 Mouse Mouse IgG2a 188166 Anti-GFP [N86/20R] GFP Aequorea victoria Mouse IgG2a 188167 Anti-...
  19. CRISPR Guide

    Type
    Guide
    ...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence... The system can use common tags, like 3xFLAG-tag, PA, and biotin tags, or an anti-Cas9 antibody. The CAPTURE...
Showing: 1 - 20 of 21 results