Skip to main content

We narrowed to 28 results for: PUR ALPHA-1

Showing: 1 - 20 of 28 results
  1. Immunology Research Plasmids and Resources

    Type
    Collection
    ...DEFA1 defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin, alpha 3, neutrophil-specific... 3 G0S19-1, LD78ALPHA, MIP-1-alpha, MIP1A, SCYA3 CCL3L1 chemokine (C-C motif) ligand 3-like 1 464.2, D17S1718...IGHDY1 IGHD1-1 immunoglobulin heavy diversity 1-1 IGHD11 IGHD1-14 immunoglobulin heavy diversity 1-14 (non-...IGHV6-1 immunoglobulin heavy variable 6-1 IGHV61, VH IGHV7-4-1 immunoglobulin heavy variable 7-4-1 IGHV7...interferon, alpha 10 MGC119878, MGC119879 IFNA13 interferon, alpha 13 - IFNA14 interferon, alpha 14 LEIF2H...interferon, alpha 16 - IFNA17 interferon, alpha 17 IFNA, INFA, LEIF2C1 IFNA2 interferon, alpha 2 IFNA, INFA2...
  2. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Anthony Brown 11908 pEGFP-N1 alpha-actinin 1 Actin Filaments alpha-actinin 1 EGFP Carol Otey 27676 Cortactin-pmCherryC1...Huttenlocher 11908 pEGFP-N1 alpha-actinin 1 Focal Adhesions alpha-actinin 1 EGFP Carol Otey 31923 pPaxillin-PSmOrange...Microtubules alpha-tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-tubulin...Microtubules alpha-tubulin mTurquoise2 Dorus Gadella 85045 pmScarlet_alphaTubulin_C1 Microtubules alpha-tubulin...mGold Francois St-Pierre 49149 mCh-alpha-tubulin Microtubules alpha-tubulin mCherry Gia Voeltz 89472 GFP-hChibby1...Beta-catenin EGFP Alpha Yap 67937 mouse E-cadherin GFP (423) Adherens Junctions E-cadherin EGFP Alpha Yap 71366...38277 pMXs-puro GFP-p62 Autophagosome Sequestosome-1 EGFP Noboru Mizushima 38272 pMXs-IP GFP-WIPI-1 Autophagosome...
  3. The Developmental Studies Hybridoma Bank: Over 25 Years of Antibody Sharing

    Type
    Blog Post
    ...transcription factors such as PAX7, PAX6, AP-2 alpha and ISLET-1. In addition, we distribute monoclonal antibodies...Monoclonal Antibody Research Institute dedicated to: 1) developing new ways of generating antibodies, for...proteins of interest for labeling, quantification, purification, chromatin immunoprecipitation and more. The...
  4. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...His, V5 EF-1 alpha Parkinson's Mark Cookson 25081 pDEST51-LRRK2-R1441C LRRK2 His, V5 EF-1 alpha Parkinson's...His, V5 EF-1 alpha Parkinson's Mark Cookson 25083 pDEST51-LRRK2-R1441H LRRK2 His, V5 EF-1 alpha Parkinson's...His, V5 EF-1 alpha Parkinson's Mark Cookson 29398 pDEST51-LRRK2-R1398Q LRRK2 His, V5 EF-1 alpha Parkinson's...His, V5 EF-1 alpha Parkinson's Mark Cookson 29400 pDEST51-LRRK2-T1343G LRRK2 His, V5 EF-1 alpha Parkinson's...307-SOD1WT SOD1 EF-1 alpha ALS Mohan Babu 83445 pLEX_307-SOD1E133delta SOD1 EF-1 alpha ALS Mohan Babu 83446...SOD1E133insTT SOD1 EF-1 alpha ALS Mohan Babu 83447 pLEX_307-SOD1E133K SOD1 EF-1 alpha ALS Mohan Babu 84347...-NE SNCA NE EF-1 alpha Parkinson's Shu Leong Ho 102366 pSIN-hSNCA-NE SNCA NE EF-1 alpha Parkinson's Shu...
  5. Validated gRNA Sequences

    Type
    Collection
    ... AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...Shaw AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens...Mendenhall rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes...TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes...
  6. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...FLPe from the EF-1 promoter pCDH-EF1-copGFP-T2A-Puro 72263 Express copGFP and the puromycin resistance gene...against mouse TNF-alpha mRNA from the mouse U6 promoter pCDH-EF1-Nluc-P2A-copGFP-T2A-Puro 73022 Expresses...Lentiviral Vector ID Purpose pCDH-EF1-DIO-copGFP 72253 Expresses copGFP under EF-1 promoter when Cre is...under EF-1 promoter when Cre is expressed by another vector pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 Cre...pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from...72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2-P2A-copGFP 72485 Expresses ...pCDH-CB-FLPe-P2A-copGFP-T2A-Puro 72258 Expresses FLPe, copGFP and the puromycin resistance from the CB promoter...
  7. 3D Printing Meets CRISPR Cas9

    Type
    Blog Post
    ... We now have another model of Cas9 – a flexible alpha-carbon backbone model made of nylon – that more ... – a mechanical device that could be used to bend 1/8th inch steel wire into a backbone structure of a...BioMolecular Modeling (CBM) in 1999 with the expressed purpose of creating physical models of proteins and other...
  8. Lentivirus Plasmids

    Type
    Collection
    ...EGFP coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression... Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid with puro resistance. See plasmid 24150...working with lentivirus: these viruses are based on HIV-1, which may require additional lab biosafety procedures... 24150 for hygro resistance. Weinberg 10878 pLKO.1 – TRC cloning plasmid 3rd U6-driven shRNA empty plasmid...and Mathis 21915 Tet-pLKO-puro 3rd inducible expression of shRNA; puromycin selection. See plasmid 21916...variations. Campeau 39481 pLenti-puro 3rd CMV driven expression of cDNA. Puro selection. Shih 25737 pSLIK-...CMV-driven EGFP fusion; can be used for cDNA expression; puro resistance Sabatini 14883 FUGW 3rd hUbC-driven EGFP...
  9. Hot Plasmids: Summer 2024

    Type
    Blog Post
    ...10.1038/s41551-024-01227-1. doi:  https://doi.org/10.1038/s41551-024-01227-1   CHARM: A compact epigenetic...with a GFP nanobody (Figure 1). This enrichment streamlines the purification and minimizes sample loss ...peptides (3HB: 11-nm 3-helix bundle; SAH: 60-nm single alpha helix) and target capture module (SpyTag-GFP nanobody...highly-visible beads on the cryo-EM grid.     Figure 1: MagIC-cryo-EM for sample enrichment and structure...single-particle analysis of PRC2 with RvLEAMshort (1:6 molar ratio) with 10 minutes of glutaraldehyde crosslinking...protocols typically require high concentration and purity of the target molecule, which can be problematic...
  10. Fluorescent Proteins 101: When GFP lets you down

    Type
    Blog Post
    ...successfully generated several functional heterotrimeric G-alpha subunit fusions that do not tolerate N- and C-terminal... remains fluorescent in acidic organelles (Figure 1), showing that its acid tolerance is maintained in...follow him on twitter: @joachimgoedhart.   References 1. Zacharias, David A., et al. "Partitioning of lipid-modified...vitro by measuring the fluorescence intensity of purified protein at different acid concentrations. Overviews...
  11. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    ...Methyltransferase 3 Alpha (DNMT3A) Vlatka Zoldoš’ lab has deposited pdCas9-DNMT3A-EGFP and pdCas9-DNMT3A-PuroR for targeted...well as pLV-dCas9-p300-P2A-PuroR for lentiviral expression. Figure 1: dCas9-p300 adds H3K27ac marks...lentiviral transduction. Lysine-specific Demethylase 1 (LSD1) Tatjana Sauka-Spengler's lab has deposited ...CRISPR, and Addgene has a number of tools for this purpose. Epigenetics began as a correlative field in which...mammalian cells. Co-expression markers EGFP and PuroR enable sorting and selection of transduced cells..., Korać P, Julg B, Klasić M, Zoldoš V (2016) Repurposing the CRISPR-Cas9 system for targeted DNA methylation...
  12. Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2:  Reprogramming and Transdifferentiation

    Type
    Blog Post
    ...Thorel, F., et al., Conversion of adult pancreatic alpha-cells to beta-cells after extreme beta-cell loss...type of choice in vitro is known as reprogramming [1]. The process can be divided into two stages: Dedifferentiation...//www.linkedin.com/in/kmukherjeephd/.  References 1. Hochedlinger, K. and R. Jaenisch, Nuclear reprogramming...from human peripheral blood. Cell Stem Cell, 2010. 7(1): p. 15-9. PubMed PMID: 20621044. PubMed Central PMCID...induced pluripotent stem cells. Hepatology, 2010. 51(1): p. 297-305. PubMed PMID: 19998274. PubMed Central... pluripotent stem cells. Nat Biotechnol, 2014. 32(1): p. 84-91. PubMed PMID: 24291815. PubMed Central ...keratinocyte lineage. Methods Mol Biol, 2014. 1195: p. 1-12. PubMed PMID: 24510784. PubMed Central PMCID: PMC4096605...
  13. Neurodegeneration Research Collection

    Type
    Collection
    ... and Noteworthy: Use a CRISPRi system to target alpha-synuclein. Sastre et al. Sci Rep. 2023 Oct 18. ...one of three different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of...Includes antibodies, viral vectors, animal models, purified protein, and more. Plasmids provided by the foundation...
  14. Sequencing Primers

    Type
    Guide
    ...promoter, forward primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, ...reverse primer XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer/promoter, forward primer Xpress Forward... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC... as pBAD-R, reverse primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer...
  15. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...concentration of puromycin should be from 1-10 μg/mL in 1 μg/mL increments. d. Label plates from 1-10 and add...of Contents A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium A.2 Map of pLKO.1 A.3 Related plasmids...Order oligos compatible with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing... References H.1 Published articles H.2 Web resources I. Appendix I.1 Sequence of pLKO.1 TRC-Cloning Vector...information Back to Top A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium The pLKO.1 cloning vector is the backbone...Appendix I.1. Sequence of pLKO.1 TRC-Cloning Vector Click here to see the sequence of pLKO.1 TRC-cloning...the puromycin resistance marker encoded in pLKO.1 allows for convenient stable selection. Figure 1 : Map...
  16. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...been used for a variety of experimental purposes including (1) single or multiple, constitutive or inducible...Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin Early Endosome Vacuolar Compartment...light-sensitive LOV2 domain of Avena Sativa phototropin 1 (AsLOV2). In the dark, this peptide is caged by the...iLID nano and 800nM to 47µM for iLID micro; Figure 1). With this great affinity range, these LIDs have ...Figure 2). They are all available now at Addgene. 1 Lungu et al., Chem Biol. 2012 Apr 20;19(4):507-17....Guntas et al., Proc Natl Acad Sci USA 2015 Jan 6; 112(1):112-7. doi: 10.1073/pnas. CRISPR-Cas9 optogenetic... al., BMC Molecular Biology. 2013 August 20th; 14(1). TRICK: A method for visualizing the first round...
  17. Viral Vectors 101: Pseudotyping

    Type
    Blog Post
    ...disadvantages: Table 1 (Joglekar et al., 2017)  Table 1 (Gutierrez-Guerrero et al., 2020) Table 1 (Cronin et al...polyA tail.   Figure 1: Lentiviral production uses three plasmids: (1) The transfer plasmid, (2)...that can be used for specific purposes as described previously (Table 1, Gutierrez-Guerrero, et al, 2020...in cell lines expressing galactosyl(alpha1-3)galactosyl (alphaGal) sugars were less stable than viruses...express these sugars. (Takeuchi et al., 1997). The alphaGal sugars end up in the envelope and are targets ...targets for complement-based killing by anti-alphaGal antibodies. The VSV-G envelope protein is inactivated ..., and spumaviruses to human serum by galactosyl(alpha1-3)galactosylation. Journal of virology 71:6174–...
  18. Plasmids 101: Common Lab E. coli Strains

    Type
    Blog Post
    ...Table 1 below outlines a few of the more common genetic changes found in E. coli strains. Table 1: Common...amber (UAG) stop codon by tyrosine insertion λ-thi-1 or thi1 Mutation in thiamine metabolism Requires exogenous... all based on E. coli K-12 and are considered BSL-1. Table 2: Lab strains of E. coli Strain Natural...plasmids, blue/white screening. F- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF...) recA13 leuB6 ara-14 proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20(SmR) glnV44 λ- JM109   General cloning and...strain for cloning repetitive DNA. endA1 glnV44 thi-1 relA1 gyrA96 recA1 mcrB+ Δ(lac-proAB) e14- [F' traD36...of an E. coli K-12 strain. F- λ- ilvG- rfb-50 rph-1 NEB Stable   For cloning into and storage of lentiviral...
  19. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Ebert pLKO.1-puro U6 sgRNA BfuAI stuffer 50920 Mammalian/Lentiviral BfuAI none S. pyogenes Puro Wolfe pL-CRISPR.EFS.tRFP... pLKO.1-puro U6 sgRNA BfuAI large stuffer 52628 Mammalian/Lentiviral BfuAI none S. pyogenes Puro Wolfe...Worm HindIII none S. pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm EcoRI none S. pyogenes de Bono...Zebrafish BseRI none S. pyogenes Zon pCRISPomyces-1 61736 Bacteria BbsI yes, cut S. pyogenes Apramycin...Chimeric_BB-CBh-hSpCas9-hGem(1/110) 71707 Mammalian hU6 yes, cut S. pyogenes Draetta pCAS1yl 73226 Other/...expression of Cas9, dCas9, or dCas9-VP64 along with 1-4 sgRNAs expressed from independent promoters. sgRNAs...for the expression of two gRNAs from Drosophila U6:1 and U6:3 promoters. Bullock pCFD5 Drosophila Utilizes...
  20. New and Upcoming Viral Vectors - May 2020

    Type
    Blog Post
    ...-fDIO mCherry 83900 AAVrg pAAV-mDlx-GFP-Fishell-1 Biosensors Plasmid Serotype Name 83899 AAVrg...pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-IRES-Puro: Expression of the SARS-CoV-2 N protein  pLVX-EF1alpha-SARS-CoV...2xStrep-IRES-Puro: Expression of the SARS-CoV-2 M protein pLVX-EF1alpha-SARS-CoV-2-orf3a-2xStrep-IRES-Puro: Expression...the E protein (pLVX-EF1alpha-SARS-CoV-2-E-2xStrep-IRES-Puro) and NSP2 (pLVX-EF1alpha-SARS-CoV-2-nsp2-2xStrep-IRES-Puro...2xStrep-IRES-Puro) are also in the works in and should be come available in the next few weeks. CRISPRi...
Showing: 1 - 20 of 28 results