...Scaria, A., Hermiston, T. W., Ryerse, J. S., Wold, L. J., & Wold, W. S. (1996). The adenovirus death protein...viral vectors, though significant challenges remain (Wold & Toth, 2013).  While the pre-existing toolbox for.../10.1128/JVI.70.4.2296-2306.1996. PMID: 8642656. Wold, W. S. M., & Toth, K. (2013). Adenovirus Vectors...

...doi.org/10.1016/j.mib.2017.05.008 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A...https://doi.org/10.1038/nrmicro3569 Makarova, K. S., Wolf, Y. I., Iranzo, J., Shmakov, S. A., Alkhnbashi, ...Moya-Beltrán, A., Makarova, K. S., Acuña, L. G., Wolf, Y. I., Covarrubias, P. C., Shmakov, S. A., Silva...

...Ravindra Kumar, S., Adams, C. D., Yang, D., Wang, T., Wolfe, D. A., Arokiaraj, C. M., Ngo, V., Campos, L. J..../doi.org/10.1016/j.neuron.2022.05.003 Chen, X., Wolfe, D. A., Bindu, D. S., Zhang, M., Taskin, N., Goertsen...Brown, D., Crosby, A., Vielmetter, J., Borsos, M., Wolfe, D. A., Lam, A. W., & Gradinaru, V. (2023). Primate-conserved...

...precision with dual-nuclease Cas9-Cas9 chimeras Scot Wolfe’s lab has developed dual-nuclease Cas9-Cas9 chimeras...

...if other antibiotics work. “We don’t want to cry wolf to the phage community until we have someone that...

...human cells. Ma H, Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. Proc Natl Acad Sci U S ...

...-Cas9 system. Mehmet Fatih Bolukbasi from Scot Wolfe's lab described a chimeric Cas9 that is improving...

... Charpentier E, Horvath P, Moineu S, Mojica FJM, Wolf YI, Yakunin JvdO, Koonin EV. Nature Reviews Microbiology...

...adapted from Strobel Benjamin, Miller Felix D., Rist Wolfgang, and Lamla Thorsten. Human Gene Therapy Methods...

...Ferrara F, Trimmer JS, Görnemann J, Glanville J, Wolf P, Frenzel A, Wong J, Koh XY, Eng H-Y, Lane D, Lefranc...

...proposed a few years later by Élie Jacob and François Wollman and became the widely adopted name for these elements...

...417144-2.00027-5van Brummelen, E. M., Ros, W., Wolbink, G., Beijnen, J. H., & Schellens, J. H. (2016)....

...https://doi.org/10.32942/X2C31F     Makarova, K. S., Wolf, Y. I., Iranzo, J., et al. (2019). Evolutionary ...

...Ferrara F, Trimmer JS, Görnemann J, Glanville J, Wolf P, Frenzel A, Wong J, Koh XY, Eng H-Y, Lane D, Lefranc...

...Crawford KHD, Eguia R, Dingens AS, Loes AN, Malone KD, Wolf CR, Chu HY, Tortorici MA, Veesler D, Murphy M, Pettie...

...Ferrara F, Trimmer JS, Görnemann J, Glanville J, Wolf P, Frenzel A, Wong J, Koh XY, Eng H-Y, Lane D, Lefranc...

...from this publication at Addgene. 4. Makarova KS, Wolf YI, Alkhnbashi OS, Costa F, Shah SA, Saunders SJ...

...24346702 Wolfe Sox17 H. sapiens GGAGGGGCAAGGGGCGGGCG 50924 activate S. pyogenes 24346702 Wolfe Sox17 H....24346702 Wolfe Sox17 H. sapiens GGGCGTGGGCCTAACGACGC 50923 activate S. pyogenes 24346702 Wolfe sqt-1 C....pyogenes 26480473 Wolfe TS3 H. sapiens GGTGAGTGAGTGTGTGCGTG 69235 cut S. pyogenes 26480473 Wolfe TS4 H. sapiens...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut...GCTGGCGGAAGACAGAGTGC 69237 cut S. pyogenes 26480473 Wolfe LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut...GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes...GGGGCGCCAGTTGTGTCTCC 50922 interfere S. pyogenes 24346702 Wolfe Oct4A (POU5F1) H. sapiens GTGGGACTGGGGAGGGAGAG 50921...

...doi.org/10.1038/s41587-019-0310-0 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A...

...Central PMCID: PMC4142810. 3. Mitalipov, S. and D. Wolf, Totipotency, pluripotency and nuclear reprogramming...