Skip to main content
Addgene
Showing: 1 - 12 of 12 results

  1. Validated gRNA Sequences

    Type
    Collection
    ...24346702 Wolfe Sox17 H. sapiens GGAGGGGCAAGGGGCGGGCG 50924 activate S. pyogenes 24346702 Wolfe Sox17 H....24346702 Wolfe Sox17 H. sapiens GGGCGTGGGCCTAACGACGC 50923 activate S. pyogenes 24346702 Wolfe sqt-1 C....pyogenes 26480473 Wolfe TS3 H. sapiens GGTGAGTGAGTGTGTGCGTG 69235 cut S. pyogenes 26480473 Wolfe TS4 H. sapiens...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut...GCTGGCGGAAGACAGAGTGC 69237 cut S. pyogenes 26480473 Wolfe LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut...GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes...GGGGCGCCAGTTGTGTCTCC 50922 interfere S. pyogenes 24346702 Wolfe Oct4A (POU5F1) H. sapiens GTGGGACTGGGGAGGGAGAG 50921...

  2. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...fluorescent proteins. Nat Commun. 2017 Sep 5;8(1):431. Wolf Frommer Calcium Red-, yellow-, or cyan-emitting ...yeast using optical sensors. Biochem J. 2010 Dec 1. Wolf Frommer ATP yAT1.03 FRET-based ATP sensor for yeast...biosensors. Proc Natl Acad Sci U S A. 2008 Jan 8. Wolfgang Dostmann cGMP (cyclic GMP) Green fluorescent probe...transport (FLIPglu) Frommer Lab FLIPglu Plasmids Wolf Frommer Glucose FRET sensor to monitor glucose levels...transport (FLIIglu) Frommer Lab FLIIglu Plasmids Wolf Frommer Glucose Green fluorescent glucose indicators...bacteria. Biotechnol Biofuels. 2008 Jun 3. 1(1):11. Wolf Frommer Maltose Green fluorescent MBP-based maltose...tracking. FEBS Lett. 2006 Oct 30. 580(25):5885-93. Wolf Frommer Pyruvate Pyronic FRET sensor for pyruvate...

  3. Bacterial Expression Systems

    Type
    Collection
    ...activation of lacZ expression from FW102 OL2-62 . Wolfe Bacterial One-Hybrid Series Various Plasmids Cloned...plates lacking histidine and containing 3-AT Scot Wolfe Bacterial one-hybrid system for testing transcription...FLIParaF.Ec-250n 18855 N/A FRET between CFP and YFP Wolf Frommer Reporter for arabinose levels in bacteria...

  4. Zinc Finger Consortium Reagents

    Type
    Collection
    ...Consortium members like the Joung Lab, Voytas Lab, and Wolfe Lab...Joung Lab plasmids Daniel Voytas Lab plasmids Scot Wolfe Lab plasmids The Zinc Finger Consortium was established...

  5. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...PMID: 27096365 Ma H, Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. 2015. Multicolor CRISPR.... Nat Biotechnol . . PMID: 27088723 Makarova KS, Wolf YI, Alkhnbashi OS, Costa F, Shah SA, Saunders SJ...

  6. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Mammalian/Lentiviral BfuAI none S. pyogenes Puro Wolfe pL-CRISPR.EFS.tRFP 57819 Mammalian/Lentiviral BsmBI...Mammalian/Lentiviral BfuAI none S. pyogenes Puro Wolfe pLKO5.sgRNA.EFS.tRFP657 57824 Mammalian/Lentiviral...

  7. KLF Research Plasmids

    Type
    Collection
    ... James Thomson Tim Townes Robert Weinberg Knut Woltjen Shinya Yamanaka Feng Zhang About The Krüppel-like...

  9. Viral Vectors

    Type
    Collection
    ...doi: 10.1016/j.bbamcr.2010.12.009. PMID: 21167871 Wold WSM, Toth K. Adenovirus vectors for gene therapy...

  10. CRISPR Guide

    Type
    Collection
    ...(6121), 823–826. PMID: 23287722 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A...28841410 Ma, H., Naseri, A., Reyes-Gutierrez, P., Wolfe, S. A., Zhang, S., & Pederson, T. (2015). Multicolor...

  11. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Esposito MS, Botta P, Chaudun F, Fadok JP, Markovic M, Wolff SB, Ramakrishnan C, Fenno L, Deisseroth K, Herry...

  12. Plasmids for Stem Cell Research

    Type
    Collection
    ...pluripotency. Stem Cell Reports. 2015 Apr 14;4(4):727-43. Woltjen Plasmid Mouse Non-integrating polycistronic expression...
Showing: 1 - 12 of 12 results