We narrowed to 12 results for: WOL
-
TypeCollection...24346702 Wolfe Sox17 H. sapiens GGAGGGGCAAGGGGCGGGCG 50924 activate S. pyogenes 24346702 Wolfe Sox17 H....24346702 Wolfe Sox17 H. sapiens GGGCGTGGGCCTAACGACGC 50923 activate S. pyogenes 24346702 Wolfe sqt-1 C....pyogenes 26480473 Wolfe TS3 H. sapiens GGTGAGTGAGTGTGTGCGTG 69235 cut S. pyogenes 26480473 Wolfe TS4 H. sapiens...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut...GCTGGCGGAAGACAGAGTGC 69237 cut S. pyogenes 26480473 Wolfe LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut...GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes...GGGGCGCCAGTTGTGTCTCC 50922 interfere S. pyogenes 24346702 Wolfe Oct4A (POU5F1) H. sapiens GTGGGACTGGGGAGGGAGAG 50921...
-
Fluorescent Protein Guide: Biosensors
TypeCollection...fluorescent proteins. Nat Commun. 2017 Sep 5;8(1):431. Wolf Frommer Calcium Red-, yellow-, or cyan-emitting ...yeast using optical sensors. Biochem J. 2010 Dec 1. Wolf Frommer ATP (extracellular) ecAT3.10 extracellular...biosensors. Proc Natl Acad Sci U S A. 2008 Jan 8. Wolfgang Dostmann cGMP (cyclic GMP) Green fluorescent probe...transport (FLIPglu) Frommer Lab FLIPglu Plasmids Wolf Frommer Glucose FRET sensor to monitor glucose levels...transport (FLIIglu) Frommer Lab FLIIglu Plasmids Wolf Frommer Glucose Green fluorescent glucose indicators...bacteria. Biotechnol Biofuels. 2008 Jun 3. 1(1):11. Wolf Frommer Maltose Green fluorescent MBP-based maltose...tracking. FEBS Lett. 2006 Oct 30. 580(25):5885-93. Wolf Frommer Pyruvate Pyronic FRET sensor for pyruvate... -
Bacterial Expression Systems
TypeCollection... (acceptor) FRET Wolf Frommer 65616 pFLIP38 ECFP (donor) Citrine (acceptor) FRET Wolf Frommer 65617 pFLIP42... (acceptor) FRET Wolf Frommer 65618 pFLIP43 ECFP (donor) mVenus (acceptor) FRET Wolf Frommer 87856 pET-BiFC...FRET fluorescence (CFP and Venus) Escherichia coli Wolf Frommer 20336 pRsetB-his7-Perceval ATP:ADP ratio...Additional Addgene Reporter Plasmids Resources The Wolfe Bacterial One-Hybrid (B1H) System can be used for... -
Zinc Finger Consortium Reagents
TypeCollection...Consortium members like the Joung Lab, Voytas Lab, and Wolfe Lab...Joung Lab plasmids Daniel Voytas Lab plasmids Scot Wolfe Lab plasmids The Zinc Finger Consortium was established... -
CRISPR History and Development for Genome Engineering
TypeCollection...PMID: 27096365 Ma H, Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. 2015. Multicolor CRISPR.... Nat Biotechnol . . PMID: 27088723 Makarova KS, Wolf YI, Alkhnbashi OS, Costa F, Shah SA, Saunders SJ... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Mammalian/Lentiviral BfuAI none S. pyogenes Puro Wolfe pL-CRISPR.EFS.tRFP 57819 Mammalian/Lentiviral BsmBI...Mammalian/Lentiviral BfuAI none S. pyogenes Puro Wolfe pLKO5.sgRNA.EFS.tRFP657 57824 Mammalian/Lentiviral... -
KLF Research Plasmids
TypeCollection... James Thomson Tim Townes Robert Weinberg Knut Woltjen Shinya Yamanaka Feng Zhang About The Krüppel-like... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...Joung Lab plasmids Daniel Voytas Lab plasmids Scot Wolfe Lab plasmids Detailed Information Protocols & Resources... -
Viral Vectors
TypeCollection...doi: 10.1016/j.bbamcr.2010.12.009. PMID: 21167871 Wold WSM, Toth K. Adenovirus vectors for gene therapy... -
CRISPR Guide
TypeCollection...(6121), 823–826. PMID: 23287722 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A...28841410 Ma, H., Naseri, A., Reyes-Gutierrez, P., Wolfe, S. A., Zhang, S., & Pederson, T. (2015). Multicolor... -
Deisseroth INTRSECT Collection
TypeCollection...Esposito MS, Botta P, Chaudun F, Fadok JP, Markovic M, Wolff SB, Ramakrishnan C, Fenno L, Deisseroth K, Herry... -
Plasmids for Stem Cell Research
TypeCollection...pluripotency. Stem Cell Reports. 2015 Apr 14;4(4):727-43. Woltjen Plasmid Mouse Non-integrating polycistronic expression...