Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 44 results for: WOL

Showing: 1 - 20 of 44 results

  1. An Introduction to Adenovirus

    Type
    Blog Post
    ...Scaria, A., Hermiston, T. W., Ryerse, J. S., Wold, L. J., & Wold, W. S. (1996). The adenovirus death protein...viral vectors, though significant challenges remain (Wold & Toth, 2013).  While the pre-existing toolbox for.../10.1128/JVI.70.4.2296-2306.1996. PMID: 8642656. Wold, W. S. M., & Toth, K. (2013). Adenovirus Vectors...

  2. Typing CRISPR Systems

    Type
    Blog Post
    ...doi.org/10.1016/j.mib.2017.05.008 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A...https://doi.org/10.1038/nrmicro3569 Makarova, K. S., Wolf, Y. I., Iranzo, J., Shmakov, S. A., Alkhnbashi, ...Moya-Beltrán, A., Makarova, K. S., Acuña, L. G., Wolf, Y. I., Covarrubias, P. C., Shmakov, S. A., Silva...

  3. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ...Ravindra Kumar, S., Adams, C. D., Yang, D., Wang, T., Wolfe, D. A., Arokiaraj, C. M., Ngo, V., Campos, L. J..../doi.org/10.1016/j.neuron.2022.05.003 Chen, X., Wolfe, D. A., Bindu, D. S., Zhang, M., Taskin, N., Goertsen...Brown, D., Crosby, A., Vielmetter, J., Borsos, M., Wolfe, D. A., Lam, A. W., & Gradinaru, V. (2023). Primate-conserved...

  4. What's New in CRISPR - Winter 2018

    Type
    Blog Post
    ...precision with dual-nuclease Cas9-Cas9 chimeras Scot Wolfe’s lab has developed dual-nuclease Cas9-Cas9 chimeras...

  15. Validated gRNA Sequences

    Type
    Collection
    ...24346702 Wolfe Sox17 H. sapiens GGAGGGGCAAGGGGCGGGCG 50924 activate S. pyogenes 24346702 Wolfe Sox17 H....24346702 Wolfe Sox17 H. sapiens GGGCGTGGGCCTAACGACGC 50923 activate S. pyogenes 24346702 Wolfe sqt-1 C....pyogenes 26480473 Wolfe TS3 H. sapiens GGTGAGTGAGTGTGTGCGTG 69235 cut S. pyogenes 26480473 Wolfe TS4 H. sapiens...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut...GCTGGCGGAAGACAGAGTGC 69237 cut S. pyogenes 26480473 Wolfe LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut...GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes...GGGGCGCCAGTTGTGTCTCC 50922 interfere S. pyogenes 24346702 Wolfe Oct4A (POU5F1) H. sapiens GTGGGACTGGGGAGGGAGAG 50921...

  19. Degrading DNA with Cascade-Cas3

    Type
    Blog Post
    ...doi.org/10.1038/s41587-019-0310-0 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A...
Showing: 1 - 20 of 44 results