Skip to main content

We narrowed to 33 results for: tdTomato

Showing: 1 - 20 of 33 results
  1. New Viral Vectors - Summer 2024

    Type
    Blog Post
    ...pAAV-Ef1a-fDIO-ChrimsonR-tdTomato AAV9 Controls Jensen New serotype pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA AAV9...multiple serotypes pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] AAV5, AAV8 Optogenetics Boyden New serotypes...
  2. Teaching an Old DOG New Tricks: Controlling Protein Activity with GFP

    Type
    Blog Post
    ...used red fluorescent proteins dsRed, mCherry, and TdTomato do not induce transcription. Thus, T-DDOGs can...expression robustly activated the reporter gene TdTomato, whose expression was absent without electroporated...T-DDOGs with two mouse GFP reporter lines; again, TdTomato was seen only in cells with GFP, at a high activation...frequency of 56-93%. In the converse test, 98% of TdTomato expressing cells were GFP+, indicating a robust...
  3. New and Upcoming Viral Vectors - Spring 2019

    Type
    Blog Post
    ...pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] pAAV-FLEX-tdTomato pAAV-GFAP104-mCherry pAAV-mDlx-NLS-mRuby2 CAG-...fluorescent-tagged molecular tool.   Find pAAV-FLEX-tdTomato, pAAV-GFAP104-mCherry, pAAV-mDlx-NLS-mRuby2, CAG-NLS-GFP... pAAV-hSyn-DIO-mCherry 59462  AAV2  pAAV-CAG-tdTomato (codon diversified) 37825  AAV8*, AAV9*  pAAV-CAG-GFP...
  4. Newly Updated AAV Data Hub!

    Type
    Blog Post
    ...AAV1 Cre virus combined with a Cre-dependent AAV9 tdTomato virus in the mPFC.  The AAV9 is so strong that...
  5. New Viral Vectors - Fall 2024

    Type
    Blog Post
    ...multiple serotypes pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] AAV1 Optogenetics Edward Boyden New serotype ...
  6. New Viral Vectors - Winter 2025

    Type
    Blog Post
    ...Roth New serotype pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato AAV8 Molecular tool Massimo Scanziani New viral...
  7. Hot Plasmids - October 2022

    Type
    Blog Post
    ... cations. B) Cortical slice of HcKCR1-EYFP and tdTomato expressed layer 2/3 neurons in mouse. C) Action...
  8. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...vector pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 Cre is coexpressed with tdTomato and Pac (puromycin N-acethyl-transferase... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP...
  9. Sequencing Primers

    Type
    Guide
    ...promoter Forward tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato Forward tdTomato-Rev TCTTTGATGACGGCCATGT...TCTTTGATGACGGCCATGT 5' end of tdTomato Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene...
  10. Control AAV Preps

    Type
    Collection
    ... Edward Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Baljit Khakh 50465 pAAV-hSyn-EGFP...PHP.eB Bryan Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Hongkui Zeng 58909 pAAV-GFAP104...Constitutive 1 Brandon Harvey 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB,... rg* Loren Looger 116870 pAAV-CAG-H2B tdTomato CAG H2B-tdTomato Constitutive rg* Loren Looger 105530 pAAV.CMV.PI.EGFP.WPRE.bGH...Brad Zuchero 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Guoping Feng... 9, rg* Karl Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHP.eB...Constitutive 2 Edward Boyden 128434 pAAV-Ef1a-fDIO-tdTomato EF1a tdTomato Flp dependent 1 Patricia Jensen 99133 pAAV-CAG-fDIO-mNeonGreen...
  11. Optogenetics AAV Preps

    Type
    Collection
    ...ChrimsonR tdTomato Cre dependent 1, 5 Edward Boyden 62726 pAAV-Syn-Chronos-tdTomato Syn Chronos tdTomato Constitutive...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Karel Svoboda 75470...ChrimsonR tdTomato Constitutive 1, 5, 9, rg* Edward Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ... 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato Flp dependent 8 Edward Boyden 100049...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Patricia Jensen... Edward Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Edward Boyden 50972 AAV-SYP1...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1, 5, 8 Edward Boyden...
  12. Caltech Systemic Capsids

    Type
    Collection
    ...pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Control...Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 37825 pAAV-CAG-GFP...CamKIIa EGFP Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 83900 pAAV-mDlx-GFP-Fishell...Dimidschstein 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Control Feng 163505 CN1390-rAAV-DLX2.0...
  13. Retrograde AAV viral preps

    Type
    Collection
    ...Cre-dependent Control Bryan Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Edward Boyden 50457 pAAV-hSyn-DIO-EGFP...Control Karl Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Edward Boyden 27056...Control Loren Looger 116870 pAAV-CAG-H2B tdTomato CAG tdTomato Control Loren Looger 24593 AAV-pgk-Cre PGK...Optogenetics Karl Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG Activator Optogenetics Karel Svoboda 26975...
  14. AAV Molecular Tools

    Type
    Collection
    ... Activity Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent...Cre-dependent expression of cytoplasmic tdTomato and synaptophysin-EGFP for labeling of axon terminals.... Liqun Luo 60658 pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato EF1a-driven, Flp-dependent Flp-dependent expression...Na+ channel mNaChBac and (physically separate) tdTomato. 8 Massimo Scanziani 34910 paavCAG-pre-mGRASP-...
Showing: 1 - 20 of 33 results