Skip to main content

We narrowed to 1,064 results for: FER

Showing: 181 - 200 of 1064 results
  1. Plasmids 101: The Wide World of Natural Plasmids

    Type
    Blog Post
    ...through horizontal (or “lateral”) gene transfer. Horizontal gene transfer can occur naturally through transformation...conjugation (direct transfer from one cell to another). Bacteria need special fertility genes to be capable...Emily P. Bentley in October 2024. References and Resources References Demanèche, S., Bertolla, F., Buret...Here at Addgene, we often refer to plasmids as lab or experimental tools. They certainly are very handy... evidence that lightning can also promote gene transfer in soil bacteria! (Demanèche et al., 2001) Beneficial...humans only noticed last century! Nevertheless, the transfer of plasmids carrying these genes between bacteria...Historically, colicin-producing plasmids have been referred to as “Col plasmids” or “Col factors.” Virulence...
  2. Plasmids 101: Broad Host Range Plasmids

    Type
    Blog Post
    ...host range is determined by the different hosts that a plasmid can transfer to, replicate in, and persist...stable, can be easily cloned in different bacteria, and can be transferred to various experimental hosts... that can replicate in different bacteria and express proteins within different host organisms. pBBR1-...recombinant vectors at Addgene!   References and resources References Doran, K. S., Konieczny, I., & Helinski...host range, identify a few of the features that confer broad host range in plasmids in nature, and provide... they carry among organisms belonging to many different phylogenetic groups (Jain and Srivastava 2013)...be used by scientists across disciplines.  What confers broad host range in plasmids? Not all plasmids ...
  3. A Guide to Designing a Scientific Poster: Content, Layout, and More

    Type
    Blog Post
    ...your poster Check conference guidelines To begin, you should always follow conference rules when designing...useful to use two different font styles; one for your section titles, and a different one for the body ...distinguished. The UCLA Library offers some Powerpoint based templates with different column numbers for a good... the most of your conference attendance Read all of our blog posts about conferences .... But, before you can show off your work at a conference, you need to first make your poster. While a ...understand that presenting your work in poster format differs in many ways from writing a manuscript. If you ...you have ever attended a scientific conference, or even a lab recruiting session at your university, you...
  4. Antibodies 101: Normalization and Loading Controls for Western Blots

    Type
    Blog Post
    ...not transfer precisely evenly across the entire blot. So how can you accurately compare different lanes...assuming that all differences in the loading control are due to loading and transfer errors — not to any...reflect massive differences in protein abundance. Validating the assumptions for different loading controls...detection range be linear! Resources and References References Aldridge, G. M., Podrebarac, D. M., Greenough...errors like uneven pipetting or irregular membrane transfer. Figure 1: A loading control is a type ...Researchers use later steps in this chain (blue) to infer or calculate things about earlier ones. In practice...relationship poses problems for proteins of very different abundance, consider the following example gel....
  5. The MTA at Addgene

    Type
    Blog Post
    ...There are many different flavors of MTAs, but the Uniform Biological Material Transfer Agreement (UBMTA...process that differs.  When you deposit a plasmid with Addgene, your organization’s tech transfer office is...for more information. Happy transferring!    Many thanks to our Tech Transfer team members Maura Coughlin...Addgene, then you’ve been involved in the material transfer agreement (MTA) process. Even though this process...curious about the hows and whys of the material transfer agreement, read on!  What is the MTA?  An MTA...UBMTA) is one of the most commonly used ones for transfers between academic institutions.  What is the UBMTA...the creation of a standardized agreement on the transfer of biological materials in 1995: the UBMTA. Because...
  6. Illuminating Choices: A Guide to Selecting Fluorescent Dyes and Ligands

    Type
    Blog Post
    ... deposited by Promega here.    References and resources   References Allikalt, A., Purkayastha, N., Flad... scientists. Seeing inside these specimens has offered illumination on biochemical processes that are ...Figure created with BioRender.com. Fluorescence refers to the emission of light by a substance (fluorophore...energy due to non-radiative energy losses. This difference in emission results in a slightly longer wavelength...phenomenon is known as the Stokes Shift, or the difference in wavelength between peak excitation spectrum...vary in their chemical structure, leading to differences in their excitation and emission wavelengths,...target specific organelles like mitochondria, and different dyes can result in varying cytoplasmic background...
  7. Luminescent Imaging with Nano-lanterns

    Type
    Blog Post
    ...Renilla luciferase variant fused to an FP; when supplied with a luciferase substrate, the luciferase transfers...bioluminescence resonance energy transfer (BRET). Photons emitted by a Renilla luciferase variant are used to excite...problems of low luminescence By itself, Renilla luciferase has a low quantum yield, and when transiently...Nano-lantern, a fusion of a mutagenized Renilla luciferase (RLuc8) with Venus. This luminescent technology...need for an excitation light source. Instead, a luciferase substrate like coelenterazine is supplied in ...technique’s versatility and adaptability to many different contexts. Improving Nano-lanterns In 2015, Takai...eNL constructs use the brightest characterized luciferase, NanoLuc, and its substrate furimazine. In addition...
  8. Understanding GPCR Signaling Using TRUPATH

    Type
    Blog Post
    ...Resonance Energy Transfer (BRET). BRET is similar to Förster Resonance Energy Transfer (FRET), in which... acceptor fluorophore. The difference for BRET is that the energy transfer is between a luminescent donor...number of different experimental approaches. They first assessed the activation of different members of...response to different agonists. These studies showed the promiscuity of GPCRs for different G protein transducers...neurotransmission. But with approximately 950 different human genes encoding GPCRs (Takeda S et al., 2002...a vast number of signaling cascades, inducing different cellular responses. One of the biggest advantages...measure the physical association of combinations of different Gα, Gβ, and Gγ subunits. When inactive, these ...
  9. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...control many cellular processes such as differentiation, proliferation, and apoptosis. In humans, mutations...Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly luciferase. The bait and prey...variable availability of enhancer sequences in different chromatin states. Alexander Stark and colleagues... were deep sequenced to identify the gRNAs that confer protection to WNV. From this screen the authors...process of cloning, combining, and testing these different parts can be quite arduous. The cloning process...consists of a variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...To facilitate innovative cancer research, the Reference Reagents Group of the NCI RAS Initiative, led ...
  10. Viral Vectors 101: AAV Variables That Matter

    Type
    Blog Post
    ... variables.    Serotypes Serotype refers to the different protein compositions of AAV capsids, which... a virus enters the cell. Different serotypes utilize a number of different receptors, co-receptors, and...burdensome in the brain where many different cell types, or even different phenotypes of the same cell type...working in several different systems or want to transduce a large number of different cells. Promoters ...doi.org/10.3389/fnmol.2014.00076 References and Resources References Aschauer, D. F., Kreuz, S., & Rumpel...validation and optimization. Although there are different ways to ultimately achieve success, we find it...validation first.  AAV-mediated gene expression can differ extensively depending on the experimental system...
  11. Antibodies 101: Immunoprecipitation

    Type
    Blog Post
    ... However, the two different approaches allow for optimized strategies for differing amounts of target ...urea-containing lysis buffer. Alternatively, the protein can also be eluted using a low pH buffer such as 0.1M ...for other antibody topics.     References and resources References:  Björck L, Kronvall G (1984) Purification... appropriate for most situations.  A slightly different method is desirable if the antibody is expected...Immobilization is the key to immunoprecipitation and simply refers to the process of anchoring an antibody, often ...eliminating the risk of the primary antibody interfering with downstream assays. This is particularly ...than those of agarose beads, despite the size difference. Magnetic beads are particularly advantageous...
  12. Promoters

    Type
    Guide
    ... Educational Resources Molecular Biology Reference Promoters Promoters Prokaryotic Promoters Eukaryotic...mRNA transcript produced. The antisense strand is referred to as the template strand or noncoding strand,...transcription of DNA into mRNA. Promoter binding is very different in bacteria compared to eukaryotes. In bacteria...promoter region. Each sigma factor recognizes different core promoter sequences. Figure 2. Basic structure...regulation, like operons. Operons are a cluster of different genes that are controlled by a single promoter...can drive expression in specific cells or under different conditions. Promoter Expression Species Description... types of RNA polymerases that all transcribe different genes: RNA polymerase I — transcribes genes encoding...
  13. Antibodies 101: Introduction to Immunofluorescence

    Type
    Blog Post
    ...target primaries produced in different species and to label targets with different colors. Multiplex immunofluorescence...Speaking of different colors, having a palette of secondary antibodies in a few different species and ...dimensional epitopes. Different sample processing steps can alter epitopes in different ways, so antibodies... a successful IF experiment.    References and resources References Im K, Mareninov S, Diaz MFP, Yong...immunohistochemistry (IHC). All three of these terms refer to the use of antibodies to visualize a target within...essentially just more general terms that can also refer to assays using non-fluorescent visualization methods...indirect immunofluorescence There are a couple different approaches to be familiar with when talking about...
  14. Antibodies 101: Stripping and Reprobing Western Blots

    Type
    Blog Post
    ...blot Run your gel and membrane transfer as normal. Immediately after transfer, dry the membrane to maximize...before rinsing with wash buffer, as dry PVDF won’t evenly re-absorb aqueous buffer. Be sure to check the ...from having to run a whole new gel and membrane transfer. Let’s get started! Before you begin In the best...abundant. If the abundance of your targets isn’t too different, consider antibody affinity: stronger binding ...should not compare the strength of bands from different rounds of detection. Finally, stripping and reprobing.... Unlike PVDF, they can be returned directly to buffer without a re-wetting step. Important: do not dry...so you’ve dried your membrane and returned it to buffer, you’ve run and imaged your western blot with your...
  15. Hot Plasmids - October 2020

    Type
    Blog Post
    ... IL-3 to proliferate. The cells cultured with a low dose of IL-3 showed reduced proliferation and had ...number, generally very small, and can contain different neurotransmitters. Using genetically encoded fluorescent... brain.  Figure 1:Schematic diagram of different FingR constructs and experimental results. Image... of the cell. By combining vectors expressing different fluorescent proteins targeting inhibitory or excitatory... proteins system for Caenorhabditis elegans By Jennifer Tsang Fluorescent proteins (FPs) traditionally...The team validated this tool by targeting six different genes whose protein products have distinct localizations...Figure 2: Split-wrmScarlet labeling proteins with different subcellular locations. Image from Goudeau et al...
  16. Production of Virus in Insect Versus Mammalian Cells

    Type
    Blog Post
    ...worry about cloning your transfer plasmid. The transfer plasmids have different packaging capacities depending... Resources References Shaw, G., Morse, S., Ararat, M., & Graham, F. L. (2002). Preferential transformation...make the virus. Viruses can be produced in many different cell types, spanning both prokaryotic and eukaryotic...However, some viruses can be produced in multiple different cell types, including plants, mammals, and insects...improve your current methods, understanding the differences can help you make an informed decision. Mammalian...AAV and lentivirus requires three plasmids — a transfer plasmid containing your gene of interest plus ...standard to do only one passage (transfection). This differs from typical insect cell preparations, which we...
  17. Hot Plasmids: Fall 2025

    Type
    Blog Post
    ...required, through mitochondrial transfer. In the two decades since this transfer was first proposed, researchers... astrocytes Nerve-to-cancer cell mitochondrial transfer tracker Red calcium indicators PinkyCaMP and FRCaMPi...better or for worse. To better understand this transfer, the Simon Grelet Lab developed MitoTRACER, a ... cancer and melanoma models, showing that this transfer increases the metabolic and metastatic capacity...it is a diverse tool that can be used in many different systems, both in vitro and in vivo. Find MitoTRACER...2023). The power and potential of mitochondria transfer. Nature, 623(7986), 283–291. https://doi.org/10.1038...-z Hoover, G., et al. (2025). Nerve-to-cancer transfer of mitochondria during cancer metastasis. Nature...
  18. Sequencing Primers

    Type
    Guide
    ...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward... Educational Resources Molecular Biology Reference Sequencing Primers Sequencing Primers Though Addgene...sequencing primers. These lists are provided for your reference, Addgene does not distribute primers. To identify...DNA, please consult Addgene's Molecular Biology Reference page . Universal Sequencing Primers Name Sequence...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ...
  19. New Tools Enable CRISPRa for Neuroscience Applications

    Type
    Blog Post
    ...expression. Gene isoforms refer to mRNAs generated from the same gene but with different untranslated or coding...activated cell sorting (FACS) to isolate differentiated from undifferentiated cells at the end of the screening... to study neuronal differentiation, it could also be applied to the differentiation of other CNS cell ..., we’ll highlight these recent advancements and offer commentary on their application to neuroscience ...straightforward to use CRISPRa to selectively target these different transcriptional start sites in order to better... expression of Bdnf resulted in hundreds of differentially expressed genes between Bdnf I-overexpressing...which transcription factors promote neuronal differentiation (Liu et al., 2018). The pooled nature of this...
  20. Antibodies 101: Polyclonal Antibodies

    Type
    Blog Post
    ... immune system make different isotypes of antibodies that recognize many different epitopes of the target... and protein G each have different affinities for IgG subtypes from different animals so it’s important...successful next experiment!     References and Resources References Ascoli CA, Aggeler B (2018) Overlooked... cover polyclonal antibodies, one of the many different types of antibodies available (others you’ll encounter...polyclonal antibodies from the serum There are a few different ways the antibodies can be isolated from the serum...by an animal are specific for the immunogen. A different type of purification can be performed to isolate...experiments where antibodies raised in several different species are present. One common example is using...
Showing: 181 - 200 of 1064 results