We narrowed to 260 results for: GFP
-
TypeCollection... 52536 rAAV-CAG::FLEX-rev:: hM4D-2a-GFP hM4D(Gi) - Inhibition GFP Cre-dependent 1 Sternson 154867 pAAV-hSyn-fDIO-hM4D...IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP none 5 Sternson 119744 AAV CAMKII PSAM4 GlyR IRES EGFP PSAM4...119741 AAV SYN flex PSAM4 GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP Cre-dependent 5, 9 Sternson 119742... Fusion tags mCherry HA Non-fusion tags mCitrine EGFP dTomato Activity Cre-dependent Flp-dependent Cre...PSAM4 GlyR - Inhibition IRES EGFP none 5 Sternson 121538 pAAV SYN1 HA-hM4D(Gi) hM4D(Gi) - Inhibition HA ...
-
Bacterial Expression Systems
TypeCollection...Vladislav Verkhusha 52732 52733 pET11a-link-NGFP pMRBAD-link-CGFP GFP (reconstructed) BiFC Lynne Regan 168257...Fluorescence (GFP+) Gram-negative bacteria Philip Poole 14460 pOT2 Promoter activity Fluorescence (GFPuv) Gram-negative... Guide to Selecting Fluorescent Dyes and Ligands GFP Fusion Proteins — Making the Right Connection Photoactivatable...pRsetB-his7-Perceval ATP:ADP ratio Fluorescence (GFP) Escherichia coli Gary Yellen 187836 pVoPo-01 Promoter...bacteria Philip Poole 14083 pAKgfplux1 Promoter activity Fluorescence (GFPmut3a) and luminescence (lux operon...bacteria Attila Karsi 14076 pAKgfp1 Promoter activity Fluorescence (GFPmut3a) Gram-negative bacteria Attila...-M ATP Fluorescence (GFPmut2) Escherichia coli Rahul Sarpeshkar 111614 pCdrA-gfpC Cyclic di-GMP Fluorescence... -
Tetracycline Inducible Expression
TypeCollection...Iwasato 63704 pRetroX GFP T2A Cre Retroviral vector for dox-inducible expression of GFP T2A Cre recombinase...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS...pTet-IRES-EGFP Lentiviral plasmid for Tet-controlled expression of transgene of interest with EGFP (On or... Off) None TRE, miniCMV Maria Lung 16542 pBI-MCS-EGFP Bidirectional promoter (Pbi) for Tet-responsive ...expression (On or Off) of both your gene of interest and EGFP. Pbi contains a TRE between two minimal CMV promoters...Retroviral Tet-On vector for CMV-driven rtTA with EGFP and Blasticidin selection rtTA-Advanced Mikhail ... -
Twenty Years of Sharing: Addgene's Viral Vector Service
TypeBlog Post... includes things like viral vectors that deliver GFP. Figure 3: A) Cumulative AAV preps available... -
Overcoming the AAV Size Limitation for CRISPR Delivery
TypeBlog Post...markers were not increased compared to a control AAV-GFP. Not only did the AAV-SaCas9-sgRNA constructs mediate... -
The Fluorescent Vegetables in Aptamer Soup
TypeBlog Post...aptamers able to bind to a small molecule derivative of GFP called 3,5-difluoro-4-hydroxybenzylidene imidazolinone... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing... FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential patterning of cGMP... vascular smooth muscle cells revealed by single GFP-linked biosensors. Proc Natl Acad Sci U S A. 2008...autophagic flux by pH-sensitive fluorescence (pMRX-IP-GFP-LC3-RFP) An Autophagic Flux Probe that Releases an... -
27 Hot Plasmids from 2016
TypeBlog Post..., Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They...with unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many ... of DsRed connected to a pH-sensitive variant of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The... -
Sequencing Primers
TypeGuide...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP... -
Hot Biosensors 2022: Year-End Roundup
TypeBlog Post...are generated by inserting a circularly-permuted GFP into an intracellular loop of various G-protein-coupled... -
Targeting HIV-1 with CRISPR: Shock and Kill or Cut it Out?
TypeBlog Post...activated HIV-1, measured via HIV-1 promoter-driven GFP expression. In cell lines that can produce HIV-1 ... -
Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons
TypeBlog Post...-2.1 construct can express one of four colors (n-GFP, RFP, YFP or M-CFP.) The construct contains two tandem... and sequence overlap (coral mOrange2, jellyfish EGFP, and sea anemone mKate2.) They then successfully... is retained in Brainbow-3.0, but with mOrange2, EGFP and mKate2 as the fluorophores; mOrange2 is the ... -
Genetic Code Expansion
TypeCollection...first with a control reporter gene – GFP for E. coli or mCherry-GFP for mammalian cells. You should also...Mammalian TAG Peter Schultz 50831 pAcBac2.tR4-OMeYRS/GFP* tyrosyl-tRNA synthetase E. coli various unnatural...or DiZHSeC Mammalian TAG P. Chen 92047 pCOTS-pyl-GFP(35TAG) PylRS M. mazei Cyanobacterial TAG Lital Alfonta...analogs Mammalian TAG Huiwang Ai 160041 pRaGE Pyl TAG GFP Y35TAG PylRS M. mazei Bacterial TAG Lital Alfonta...C321.Ub-UAG-sfGFP all TAG sites changes to UAG, RF1 function removed, with Ubiquitin-UAG-sfGFP reporter ...reporter George Church 98565 C321.ΔClpS.Ub-UAG-sfGFP all TAG sites changes to UAG, RF1 function removed, ClpS...ClpS inactivated, with Ubiquitin-UAG-sfGFP reporter George Church 174513 Syn61 No TCG, TCA, or TAG codons... -
Luciferase Plasmid Collection
TypeCollection...Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP James Wilson...phGluc Gaussia EF1α Expression of Gaussia luciferase; GFP is expressed if cells are infected with virus Christopher...extracellular pH sensor consisting of a pH-sensitive GFP (superecliptic pHluorin), a pH-stable OFP (Antares... with a fluorophore as the acceptor. LumiFluors: EGFP-NanoLuc ( GpNLuc ) and LSSmOrange-NanoLuc ( OgNLuc... -
Lentivirus Plasmids
TypeCollection...hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA ...expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway...expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid...14748 pLKO.3G 3rd U6-driven shRNA empty plasmid with EGFP marker. See plasmid 14749 for Thy1.1 selection. ...3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression... -
Feng Zhang Multiplexed Overexpression of Regulatory Factors (MORF) Collection
TypeCollection...transcription factor open reading frames with or without GFP and mCherry controls. Do you have suggestions for... -
CRISPR Plasmids for Genomic Visualization
TypeCollection... Cas9 (dCas9) fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable... -
CRISPR Plasmids - Tagging
TypeCollection... general cloning plasmid, and a prebuilt Unc-32::GFP targeting vector. Jorgensen Lab SapTrap CRISPR/Cas...provide PCR templates for amplification of the tag (eg GFP, Flag, YFP, etc) and selection markers. Two independent...PITCh system plasmids for CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous...the donor vector. The PITCh donor plasmid with an EGFP-2A-PuroR cassette, flanked by microhomologous sequences...first deposited PITCh plasmids were tested by fusing EGFP-2A-PuroR cassette to a nucleolar protein, fibrillarin... gRNA pCRIS-PITChv2-FBL - PITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locus Jorgensen... the donor plasmids containing homology arms and EGFP are available at Addgene. Do you have suggestions... -
All Antibodies
TypeCollection...popular markers like tubulin or epitope tags like Myc, GFP, and more. Neuroscience : Antibodies targeting proteins... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection... pX459 (Addgene plasmid ID 48139), which include GFP and puromycin as selectable markers, respectively...CRISPR/Cas9 construct (10 μg total). Add 0.5 μg of GFP expression construct. Electroporate cells with 250...filter into a FACS tube. FACS sort the top ~3% of GFP positive cells in order to enrich for cells that ...