Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 494 results for: control

Showing: 181 - 200 of 494 results

  1. Special Delivery: Fluorophore Targeting for FRET Studies

    Type
    Blog Post
    ...needed and when is it not? What are the proper controls needed to pressure-test your FRET assay to make...molecular distances (see Table). However, proper control experiments are needed to establish the dynamic...These experiments include producing a positive control construct where the donor and the acceptor fluorophore... each other on the same protein and a negative control experiment conducted on donor-only labeled protein...

  2. QC Sequencing Technologies at Addgene

    Type
    Blog Post
    ...process, see our blog post on NGS plasmid quality control. NGS is generally cheaper if you have many samples...to sequence our packaged viral DNA for quality control. This gives us a faster turnaround time than short-read...Validation: seqWell Addgene’s Tips for Plasmid Quality Control Additional Resources on addgene.org Molecular...

  3. Hot Plasmids Spring 2024

    Type
    Blog Post
    ...membrane protein (Plasmid #141386-LV [+M], negative control) were immunoblotted against Anti-SARS-CoV-2 Nucleocapsid...also immunoblotted against vinculin as a loading control (right panel). Image from Addgene. These antibodies...trans-splicing. A cis-splicing vector served as positive control (cis-ctrl). v1, vector 1; v2, vector 2; BD, binding...

  4. Zebrafish Plasmid Collection

    Type
    Collection
    ...optogenetically controlled Cre/loxP system that enables precise temporal and spatial control of gene expression...

  5. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...mTurquoise2 Brightness standard used as positive control to characterize mTurquoise2 pmTurquoise2-T2A-Venus...T2A-Venus(L68V) Brightness standard used a negative control (no FRET) with pmVenus(L68V)-mTurquoise2 Back to...

  7. In Vivo Biotinylation of Bacterial Fusion Proteins

    Type
    Blog Post
    ...oligomerization of biotinylated proteins on avidin can be controlled easier than formation of GST dimers. Avi-Tag ... of added biotins per molecule cannot be well-controlled. The lack of site selectivity typically diminishes...

  8. Hot Plasmids and Viral Preps - September 2021

    Type
    Blog Post
    ...cell free system allows for a relatively simple, controlled “one-pot” reaction capable of reproducing useful... and 5HT sensors New AAV tools to selectively control parvalbumin interneurons from the Dimidschstein...

  10. Harnessing Bacterial Toxins for Allelic Exchange

    Type
    Blog Post
    ...rhamnose- and arabinose-inducible promoters. Tight control of toxin expression is absolutely necessary, because...Proteobacteria. We placed the toxin genes under control of a rhamnose-inducible promoter, though Khetrapal...Channarasappa, and Howard M. Salis. "Translation rate is controlled by coupled trade-offs between site accessibility...

  11. Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons

    Type
    Blog Post
    ...most important ways to spatially and temporally control gene expression, especially in in vivo models, ...functionally similar to Cre-based Brainbow, but is controlled by FLP/FRT recombinase. When placed under different.... The use of AAV provides spatial and temporal control without the need for germline modification, and...

  14. Addgene’s Viral Service - Why Virus? Why Now?

    Type
    Blog Post
    ...team develops methods, performs extensive quality control, generates  educational materials, and provides...details about virus production protocols and quality control can be found on Addgene’s Viral Production webpage...

  15. With Our New Viral Service, We're Taking CRISPR Further!

    Type
    Blog Post
    ...The gRNAs targeting EGFP can be used as positive controls for gene editing or gene activation, while the...from your primary goal. Getting these quality-controlled reagents from Addgene can greatly expedite a ...

  16. Antibodies 101: ChIP

    Type
    Blog Post
    ...need to ensure you have a bead-only control alongside your input control. Elute the DNA after washing and...

  19. Validated gRNA Sequences

    Type
    Collection
    ...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...
Showing: 181 - 200 of 494 results