We narrowed to 754 results for: REV

...preparation, staining procedures, and controls. To prevent instrument clogs, ensure that samples are single... LA (1972) Fluorescence Activated Cell Sorting. Review of Scientific Instruments 43:404–409 . https://...

...super-resolution imaging of ER and mitochondria reveals dynamic organelle interactions. a) Labeling scheme...filament assembly-regulating proteins in vitro reveals complex events. a) Micrographs of a fluorescently-labeled...

...addition of glycerol stabilizes the frozen bacteria, preventing damage to the cell membranes and keeping the ...stock on dry ice while streaking onto LB agar will prevent it from thawing completely and will improve the...

... stem cells: reprogramming à la carte." Nature Reviews Genetics 12, no. 4 (2011): 231-42. PubMed PMID:...reference. 1. Malik, Nasir, and Mahendra S. Rao. "A Review of the Methods for Human iPSC Derivation." Methods...

...primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 ...D., Lin, C., Gootenberg, J. S., Konermann, S., Trevino, A. E., Scott, D. A., Inoue, A., Matoba, S., Zhang...

...expression of a catalytically dead Cas9 enzyme allows reversible repression based on the presence of the inducer...modulation. CRISPRa from sigma-54 promoters Noting that previous work in bacterial CRISPRa had focused on sigma...

...Nalgene, 565-0010 (for viral preps, if prep was not previously filtered) Microcentrifuge tubes, Neptune 3745...expression using fluorescence microscopy. Last reviewed on: September 9, 2023...

...in BSL-1, along with additional precautions to prevent injuries, ingestion, and exposures to hazardous... the work. Before working with chemicals, first review their material safety data sheets (MSDS). While...

... time, allow them to mix and recheck the pH to prevent over or undershooting the desired pH. Allow the...panels) with a limited effect on cell growth. Last reviewed on: November 7, 2023...

...insert will be added in the correct orientation and prevents the vector from ligating to itself during the ...phosphatase removes the 5' phosphate and therefore prevents the ligase from being able to fuse the two ends...

...and the other holding the arm - or use a cart. Revolve the nosepiece so that the lowest power objective...your eyes away from the eyepiece and carefully revolve the nosepiece so that the next objective is in ...

... needed to prevent contamination. When not in use, the tip box should be closed to prevent contamination...

...bottles. The extra empty volume is necessary to prevent your molten agar from boiling over in the autoclave...psi for at least 30 min. The high pressure will prevent your gel mix from boiling over at high temperature...

...depositing their data with us through our newly revamped Data Hub! The community needs more data-sharing...

...away from the functionality and features that previously made the platform a mainstay of conversation ...

...Addgene gave to me: Functional Genetic Variants Revealed by Massively Parallel Precise Genome Editing (...

...on CRISPR and synBio plasmid sharing In a recent review on CRISPR technology, for example, the authors ...

..., the Phuels lab deposited a plasmid that will forever change the fly lab experience. The Frequency Light...

...promoter, or tool type. Drilling into any entry will reveal additional data including the subject’s age at ...

...evolving, but sometimes a technology is so useful it forever enhances biological research and discovery. CRISPR...

...Preparation is a key step to any experiment and can help prevent future headaches. To help you plan PEI transfections...

...Up with the Literature How to Write a Scientific Review Article Tips for Improving Your Next Manuscript...

...winners for each edition and the winners will be revealed on Twitter and Instagram shortly after. Have fun...

...evidence was destroyed to protect the innocent revelers. Our Halloween costume contests have become an...

...50 units.  Once your request is received, we’ll review for technical and legal compliance, and then send...

...tumors, demonstrating that this system can also reveal novel pathways. The FITS deposit also includes ...

...We're excited to roll out the redesigned, revamped, and re-launched Addgene AAV Data Hub, the place for...

...form of a discussion between myself and two of my previous graduate school classmates, Ben Vincent and Niroshi...

...second round of plasmid awards on June 15th. As previously, these awards will be open to researchers who...

... Consolidate your autoclave runs. In one of my previous labs, we had a communal tray that everyone could...

... Plasmids start out at our Cambridge office – previously at 1 Kendall Square, but newly relocated to 75...

...which, in the absence of support and structure, prevent science from attracting and keeping diverse talent...

..., request, and educational resources page, and previews for our three most recent blog posts. Finally,...

...have increased lentiviral titer as compared to previous lentiviral vectors. It can be used both to knock-out...

...such as cloning their gene of interest into a previously deposited vector - then you'll find the plasmids...

...Edit DNA" and "This Protein Could Change Biotech Forever."  David S. Weiss of Emory University summed it...

...obtained using commercially available cells or previous batches of homemade competent cells to ensure ...

... I was once again fascinated by the world that reveals itself when looking down a paper thin and very ...

...residues and the bNLS and NES sequences, which have previously been characterized. See Box 1 in Kudo et al. ...

...spectrum that GFP and its derivatives did not previously reach. Nobel Prize for fluorescent proteins The...