Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 268 results for: gnal

Showing: 261 - 268 of 268 results

  1. Sequencing Primers

    Type
    Guide
    ...Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward pBAD Forward...Alpha-factor TACTATTGCCAGCATTGCTGC Alpha factor signal sequence Forward Amp-R ATAATACCGCGCCACATAGC 5' ...GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG 3...

  2. CRISPR Guide

    Type
    Guide
    ...PAM) The PAM sequence (NGG) serves as a binding signal for Cas9, but the exact sequence depends on which...the aptamer improves stability and amplifies the signal for better imaging of genomic loci, as in the CRISPR-Sirius...degraded by Cas12a, it will release a quantifiable signal that indicates the presence of your target DNA ...cleaves the reporter as well, and a quantifiable signal is produced, indicating the presence of that specific...Pederson, T. (2018). CRISPR-Sirius: RNA scaffolds for signal amplification in genome imaging. Nature Methodss...Vale, R. D. (2014). A Protein-Tagging system for signal amplification in gene expression and fluorescence...

  3. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... nuclear export. Poly(A) signal in cis The polyadenylation or poly(A) signal aids in the nuclear export...serve as origins of replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. ...used to detect, measure, and control molecular signals of cells (commonly neurons) in response to light...

  4. Science Guides

    Type
    Guide
    ...applications, which often use antibodies conjugated to a signaling molecule, can be used to capture, quantify, and...receptors to selectively control and investigate cell signaling pathways. Receptors are remotely controlled via...light to detect, measure, and control molecular signals and cells in order to understand their functions...

  5. Modular Cloning Guide

    Type
    Guide
    ...transcriptional unit (for example, a promoter, a 5' UTR, a signal peptide, a protein-coding gene, and a terminator...backbones, fluorescent proteins, protein tags, and signal peptides, for use in a range of organisms including...

  6. Promoters

    Type
    Guide
    ... Promoters Plasmids 101: Terminators and PolyA signals More Plasmids 101 topics Content last reviewed:...

  7. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...increased nuclear export. Psi (Ѱ) in cis RNA packaging signal; recognized by nucleocapsid proteins and essential...

  8. Lentiviral Vector Guide

    Type
    Guide
    ...Rev protein binds. Psi (Ѱ) in cis RNA packaging signal; recognized by nucleocapsid proteins and essential...
Showing: 261 - 268 of 268 results